EMAIL THIS PAGE TO A FRIEND

C6orf62

chromosome 6 open reading frame 62

115 Gene Product Result for
Synonyms: Nbla00237 XTP12 dJ30M3.2
Species: Human C6orf62(81688)
UniProtKB ID: Q9GZU0, Q3LIB6, Q5JVZ2, Q5JVZ3, Q6IA63, Q9H1Z2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030939 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155181 MISSION® esiRNA esiRNA human C6orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030939 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099792 predicted 828
2 SASI_Hs01_00099794 predicted 687
3 SASI_Hs01_00099795 predicted 677
4 SASI_Hs01_00099796 predicted 674
5 SASI_Hs01_00099797 predicted 1569
6 SASI_Hs01_00099798 predicted 684
7 SASI_Hs01_00099799 predicted 807
8 SASI_Hs01_00099800 predicted 802
9 SASI_Hs01_00099801 predicted 1009
10 SASI_Hs02_00358514 predicted 675
11 SASI_Hs01_00099793 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030939
VALIDATED
C6orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 62
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-903s21c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-728s21c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-946s21c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-577s21c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-755s1c1
Sequence:CCGGGATTCCAGCTATTCCTTGGAACTCGAGTTCCAAGGAATAGCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-608s1c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1122s1c1
Sequence:CCGGCAATCTTCAAGTTATGCAGCACTCGAGTGCTGCATAACTTGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030939.2-1041s1c1
Sequence:CCGGGAATCGTTGTCAACAATCCTACTCGAGTAGGATTGTTGACAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-934s1c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-977s1c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1059s1c1
Sequence:CCGGCTAACCAGTCAGTGTTTCTCTCTCGAGAGAGAAACACTGACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-759s1c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030939
VALIDATED
C6orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 62
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-903s21c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-728s21c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-946s21c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-577s21c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-755s1c1
Sequence:CCGGGATTCCAGCTATTCCTTGGAACTCGAGTTCCAAGGAATAGCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-608s1c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1122s1c1
Sequence:CCGGCAATCTTCAAGTTATGCAGCACTCGAGTGCTGCATAACTTGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030939.2-1041s1c1
Sequence:CCGGGAATCGTTGTCAACAATCCTACTCGAGTAGGATTGTTGACAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-934s1c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-977s1c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1059s1c1
Sequence:CCGGCTAACCAGTCAGTGTTTCTCTCTCGAGAGAGAAACACTGACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-759s1c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030939
VALIDATED
C6orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 62
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-903s21c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-728s21c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-946s21c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030939.4-577s21c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137514    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-755s1c1
Sequence:CCGGGATTCCAGCTATTCCTTGGAACTCGAGTTCCAAGGAATAGCTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-608s1c1
Sequence:CCGGGAATCTCTAGCTGACCAGTTTCTCGAGAAACTGGTCAGCTAGAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1122s1c1
Sequence:CCGGCAATCTTCAAGTTATGCAGCACTCGAGTGCTGCATAACTTGAAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030939.2-1041s1c1
Sequence:CCGGGAATCGTTGTCAACAATCCTACTCGAGTAGGATTGTTGACAACGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-934s1c1
Sequence:CCGGGAAAGAATCTGATGAGCCTTTCTCGAGAAAGGCTCATCAGATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136140    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-977s1c1
Sequence:CCGGGAGTTTCATCATGGTGACTATCTCGAGATAGTCACCATGATGAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030939.2-1059s1c1
Sequence:CCGGCTAACCAGTCAGTGTTTCTCTCTCGAGAGAGAAACACTGACTGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_030939.2-759s1c1
Sequence:CCGGCCAGCTATTCCTTGGAAAGTTCTCGAGAACTTTCCAAGGAATAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks