EMAIL THIS PAGE TO A FRIEND

C6orf89

chromosome 6 open reading frame 89

124 Gene Product Result for
Synonyms: BRAP
Species: Human C6orf89(221477)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152734 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081841 MISSION® esiRNA esiRNA human C6orf89 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152734 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152734 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218359 predicted 1006
2 SASI_Hs01_00218360 predicted 882
3 SASI_Hs01_00218361 predicted 879
4 SASI_Hs01_00218362 predicted 1008
5 SASI_Hs01_00218363 predicted 776
6 SASI_Hs01_00218364 predicted 608
7 SASI_Hs01_00218365 predicted 850
8 SASI_Hs01_00218366 predicted 799
9 SASI_Hs01_00218367 predicted 570
10 SASI_Hs01_00218368 predicted 850
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152734
VALIDATED
C6orf89 MISSION shRNA Bacterial Glycerol Stock
chromosome 6 open reading frame 89
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1028s1c1
Sequence:CCGGCATTTCCTTATCCATGGAGGACTCGAGTCCTCCATGGATAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-831s1c1
Sequence:CCGGGAAACACCTGAAGGTGATGCTCTCGAGAGCATCACCTTCAGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1314s1c1
Sequence:CCGGCCACTGGAAGGTCTACGTTATCTCGAGATAACGTAGACCTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-784s1c1
Sequence:CCGGCAGAATGAGTCAGAGCCCATTCTCGAGAATGGGCTCTGACTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-768s1c1
Sequence:CCGGGACAAACGACTGTGAGCAGAACTCGAGTTCTGCTCACAGTCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-736s1c1
Sequence:CCGGGACAGACCCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1023s1c1
Sequence:CCGGGTTCCCATTTCCTTATCCATGCTCGAGCATGGATAAGGAAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1248s1c1
Sequence:CCGGCCGAAGACATTGTCAGTCTGTCTCGAGACAGACTGACAATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1059s1c1
Sequence:CCGGCAGATCACAAATGTTACGTGACTCGAGTCACGTAACATTTGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1177s1c1
Sequence:CCGGCATAAGATGCCTGACCTATTTCTCGAGAAATAGGTCAGGCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152734.1-1064s1c1
Sequence:CCGGCACAAATGTTACGTGAGCTTTCTCGAGAAAGCTCACGTAACATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152734
VALIDATED
C6orf89 MISSION shRNA shRNA Plasmid DNA
chromosome 6 open reading frame 89
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1028s1c1
Sequence:CCGGCATTTCCTTATCCATGGAGGACTCGAGTCCTCCATGGATAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-831s1c1
Sequence:CCGGGAAACACCTGAAGGTGATGCTCTCGAGAGCATCACCTTCAGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1314s1c1
Sequence:CCGGCCACTGGAAGGTCTACGTTATCTCGAGATAACGTAGACCTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-784s1c1
Sequence:CCGGCAGAATGAGTCAGAGCCCATTCTCGAGAATGGGCTCTGACTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-768s1c1
Sequence:CCGGGACAAACGACTGTGAGCAGAACTCGAGTTCTGCTCACAGTCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-736s1c1
Sequence:CCGGGACAGACCCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1023s1c1
Sequence:CCGGGTTCCCATTTCCTTATCCATGCTCGAGCATGGATAAGGAAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1248s1c1
Sequence:CCGGCCGAAGACATTGTCAGTCTGTCTCGAGACAGACTGACAATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1059s1c1
Sequence:CCGGCAGATCACAAATGTTACGTGACTCGAGTCACGTAACATTTGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1177s1c1
Sequence:CCGGCATAAGATGCCTGACCTATTTCTCGAGAAATAGGTCAGGCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152734.1-1064s1c1
Sequence:CCGGCACAAATGTTACGTGAGCTTTCTCGAGAAAGCTCACGTAACATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152734
VALIDATED
C6orf89 MISSION shRNA Lentiviral Transduction Particles
chromosome 6 open reading frame 89
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1028s1c1
Sequence:CCGGCATTTCCTTATCCATGGAGGACTCGAGTCCTCCATGGATAAGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-831s1c1
Sequence:CCGGGAAACACCTGAAGGTGATGCTCTCGAGAGCATCACCTTCAGGTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1314s1c1
Sequence:CCGGCCACTGGAAGGTCTACGTTATCTCGAGATAACGTAGACCTTCCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-784s1c1
Sequence:CCGGCAGAATGAGTCAGAGCCCATTCTCGAGAATGGGCTCTGACTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-768s1c1
Sequence:CCGGGACAAACGACTGTGAGCAGAACTCGAGTTCTGCTCACAGTCGTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-736s1c1
Sequence:CCGGGACAGACCCTTTCCAGACTTTCTCGAGAAAGTCTGGAAAGGGTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1023s1c1
Sequence:CCGGGTTCCCATTTCCTTATCCATGCTCGAGCATGGATAAGGAAATGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1248s1c1
Sequence:CCGGCCGAAGACATTGTCAGTCTGTCTCGAGACAGACTGACAATGTCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152734.1-1059s1c1
Sequence:CCGGCAGATCACAAATGTTACGTGACTCGAGTCACGTAACATTTGTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_152734.1-1177s1c1
Sequence:CCGGCATAAGATGCCTGACCTATTTCTCGAGAAATAGGTCAGGCATCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152734.1-1064s1c1
Sequence:CCGGCACAAATGTTACGTGAGCTTTCTCGAGAAAGCTCACGTAACATTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks