EMAIL THIS PAGE TO A FRIEND

C7

complement component 7

125 Gene Product Result for
UniProtKB ID: P10643, Q6P3T5, Q92489
Gene ID:
Human(730) Summary: C7 is a component of the complement system. It participates in the formation of Membrane Attack Complex (MAC). People with C7 deficiency are prone to bacterial infection. [provided by RefSeq, Jul 2008]
Mouse(109828) complement component 7
Rat(117517) complement component 7
sheep(101102931) complement component 7
naked mole-rat(101721601) complement component 7
domestic guinea pig(100713100) complement component 7
chicken(427187) complement component 7
dog(489221) complement component 7
domestic cat(101094482) complement component 7
Horse(100066126) complement component 7
cow(507339) complement component 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000587 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000587 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000587 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_356827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004001 MISSION® esiRNA esiRNA targeting human C7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000587 Rosetta Predictions human pricing
XM_001054007 Rosetta Predictions rat pricing
XM_226803 Rosetta Predictions rat pricing
XM_356827 Rosetta Predictions mouse pricing
XM_904680 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000587 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170730 predicted 849
2 SASI_Hs01_00170731 predicted 660
3 SASI_Hs01_00170732 predicted 2048
4 SASI_Hs01_00170733 predicted 2469
5 SASI_Hs01_00170734 predicted 876
6 SASI_Hs02_00302857 predicted 1530
7 SASI_Hs01_00170735 predicted 1257
8 SASI_Hs01_00170736 predicted 1906
9 SASI_Hs01_00170737 predicted 1392
10 SASI_Hs01_00170738 predicted 1329
11 SASI_Hs01_00170729 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054007 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274322 predicted 717
2 SASI_Rn02_00274323 predicted 478
3 SASI_Rn02_00274324 predicted 503
4 SASI_Rn02_00274325 predicted 1510
5 SASI_Rn02_00274326 predicted 1444
6 SASI_Rn02_00274327 predicted 621
7 SASI_Rn02_00274328 predicted 797
8 SASI_Rn02_00274329 predicted 702
9 SASI_Rn02_00274330 predicted 1049
10 SASI_Rn02_00274331 predicted 1666
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226803 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383885 predicted 725
2 SASI_Rn02_00383886 predicted 485
3 SASI_Rn02_00383887 predicted 512
4 SASI_Rn02_00383888 predicted 1515
5 SASI_Rn02_00383889 predicted 1459
6 SASI_Rn02_00383890 predicted 624
7 SASI_Rn02_00383891 predicted 806
8 SASI_Rn02_00383892 predicted 710
9 SASI_Rn02_00383893 predicted 1054
10 SASI_Rn02_00383894 predicted 1682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425987 predicted 1126
2 SASI_Mm01_00260806 predicted 300
3 SASI_Mm01_00260807 predicted 593
4 SASI_Mm01_00260809 predicted 908
5 SASI_Mm02_00425988 predicted 269
6 SASI_Mm01_00260812 predicted 856
7 SASI_Mm02_00425989 predicted 1305
8 SASI_Mm01_00260814 predicted 1239
9 SASI_Mm02_00425990 predicted 400
10 SASI_Mm02_00425991 predicted 283
11 SASI_Mm01_00260808 predicted 923
12 SASI_Mm01_00260810 predicted 622
13 SASI_Mm01_00260811 predicted 290
14 SASI_Mm01_00260813 predicted 288
15 SASI_Mm01_00260815 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904680 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431100 predicted 297
2 SASI_Mm02_00431101 predicted 1711
3 SASI_Mm02_00431102 predicted 596
4 SASI_Mm02_00431103 predicted 907
5 SASI_Mm02_00431104 predicted 1627
6 SASI_Mm02_00431105 predicted 857
7 SASI_Mm02_00431106 predicted 1692
8 SASI_Mm02_00431107 predicted 1303
9 SASI_Mm02_00431108 predicted 1854
10 SASI_Mm02_00431109 predicted 1243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000587
C7 MISSION shRNA Bacterial Glycerol Stock
complement component 7
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1837s1c1
Sequence:CCGGCCTGCCTTGAAAGATGGATTTCTCGAGAAATCCATCTTTCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-401s1c1
Sequence:CCGGGCATCAGCAAATCATTGGTTTCTCGAGAAACCAATGATTTGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-990s1c1
Sequence:CCGGCCGAAGATTAATCGACCAGTACTCGAGTACTGGTCGATTAATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-2299s1c1
Sequence:CCGGGCTCAAGATGAGAGAAGCAAACTCGAGTTTGCTTCTCTCATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1718s1c1
Sequence:CCGGGCGTTGGAGAAACGACAGAAACTCGAGTTTCTGTCGTTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000587.2-2807s21c1
Sequence:CCGGCCCAAATCTGAATCGAATTACCTCGAGGTAATTCGATTCAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000587.2-799s21c1
Sequence:CCGGTCATCTTCTTCACGCAGTTATCTCGAGATAACTGCGTGAAGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000587
C7 MISSION shRNA shRNA Plasmid DNA
complement component 7
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1837s1c1
Sequence:CCGGCCTGCCTTGAAAGATGGATTTCTCGAGAAATCCATCTTTCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-401s1c1
Sequence:CCGGGCATCAGCAAATCATTGGTTTCTCGAGAAACCAATGATTTGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-990s1c1
Sequence:CCGGCCGAAGATTAATCGACCAGTACTCGAGTACTGGTCGATTAATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-2299s1c1
Sequence:CCGGGCTCAAGATGAGAGAAGCAAACTCGAGTTTGCTTCTCTCATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1718s1c1
Sequence:CCGGGCGTTGGAGAAACGACAGAAACTCGAGTTTCTGTCGTTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000587.2-2807s21c1
Sequence:CCGGCCCAAATCTGAATCGAATTACCTCGAGGTAATTCGATTCAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000587.2-799s21c1
Sequence:CCGGTCATCTTCTTCACGCAGTTATCTCGAGATAACTGCGTGAAGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000587
C7 MISSION shRNA Lentiviral Transduction Particles
complement component 7
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1837s1c1
Sequence:CCGGCCTGCCTTGAAAGATGGATTTCTCGAGAAATCCATCTTTCAAGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-401s1c1
Sequence:CCGGGCATCAGCAAATCATTGGTTTCTCGAGAAACCAATGATTTGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-990s1c1
Sequence:CCGGCCGAAGATTAATCGACCAGTACTCGAGTACTGGTCGATTAATCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-2299s1c1
Sequence:CCGGGCTCAAGATGAGAGAAGCAAACTCGAGTTTGCTTCTCTCATCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000587.2-1718s1c1
Sequence:CCGGGCGTTGGAGAAACGACAGAAACTCGAGTTTCTGTCGTTTCTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000587.2-2807s21c1
Sequence:CCGGCCCAAATCTGAATCGAATTACCTCGAGGTAATTCGATTCAGATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000587.2-799s21c1
Sequence:CCGGTCATCTTCTTCACGCAGTTATCTCGAGATAACTGCGTGAAGAAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356827
C7 MISSION shRNA Bacterial Glycerol Stock
complement component 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-643s1c1
Sequence:CCGGCGACGGTTAATCGATCAGTATCTCGAGATACTGATCGATTAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1301s1c1
Sequence:CCGGCCTGTGTTCAAGGGAAGAGAACTCGAGTTCTCTTCCCTTGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-139s1c1
Sequence:CCGGGTGTGCTTTATAGCAGCGTTTCTCGAGAAACGCTGCTATAAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1188s1c1
Sequence:CCGGCCAGTGTCTGTGCAAACCATACTCGAGTATGGTTTGCACAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1959s1c1
Sequence:CCGGCCGAGATGAGAGTAGAAACAACTCGAGTTGTTTCTACTCTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356827
C7 MISSION shRNA shRNA Plasmid DNA
complement component 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-643s1c1
Sequence:CCGGCGACGGTTAATCGATCAGTATCTCGAGATACTGATCGATTAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1301s1c1
Sequence:CCGGCCTGTGTTCAAGGGAAGAGAACTCGAGTTCTCTTCCCTTGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-139s1c1
Sequence:CCGGGTGTGCTTTATAGCAGCGTTTCTCGAGAAACGCTGCTATAAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1188s1c1
Sequence:CCGGCCAGTGTCTGTGCAAACCATACTCGAGTATGGTTTGCACAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1959s1c1
Sequence:CCGGCCGAGATGAGAGTAGAAACAACTCGAGTTGTTTCTACTCTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356827
C7 MISSION shRNA Lentiviral Transduction Particles
complement component 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-643s1c1
Sequence:CCGGCGACGGTTAATCGATCAGTATCTCGAGATACTGATCGATTAACCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1301s1c1
Sequence:CCGGCCTGTGTTCAAGGGAAGAGAACTCGAGTTCTCTTCCCTTGAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-139s1c1
Sequence:CCGGGTGTGCTTTATAGCAGCGTTTCTCGAGAAACGCTGCTATAAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1188s1c1
Sequence:CCGGCCAGTGTCTGTGCAAACCATACTCGAGTATGGTTTGCACAGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_356827.3-1959s1c1
Sequence:CCGGCCGAGATGAGAGTAGAAACAACTCGAGTTGTTTCTACTCTCATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks