EMAIL THIS PAGE TO A FRIEND

C7orf10

chromosome 7 open reading frame 10

37 Gene Product Result for
Synonyms: DERP13 ORF19
Gene ID:
Human(79783) Summary: This gene encodes a protein that is similar to members of the CaiB/baiF CoA-transferase protein family. Mutations in this gene are associated with glutaric aciduria type III. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
chicken(420768) chromosome 2 open reading frame, human C7orf10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024728 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024728 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093018 predicted 316
2 SASI_Hs01_00093019 predicted 455
3 SASI_Hs01_00093021 predicted 659
4 SASI_Hs01_00093022 predicted 754
5 SASI_Hs01_00093024 predicted 332
6 SASI_Hs01_00093026 predicted 575
7 SASI_Hs02_00357201 predicted 608
8 SASI_Hs01_00093027 predicted 317
9 SASI_Hs02_00357202 predicted 775
10 SASI_Hs02_00357203 predicted 557
11 SASI_Hs01_00093020 predicted 657
12 SASI_Hs01_00093023 predicted 360
13 SASI_Hs01_00093025 predicted 798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024728
VALIDATED
C7orf10 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 10
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-1359s21c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-333s21c1
Sequence:CCGGTCTCAGTGTTAACCGAAATAACTCGAGTTATTTCGGTTAACACTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-787s21c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-275s21c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-1167s21c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-561s1c1
Sequence:CCGGCCTGTATGCATATGGAGCTATCTCGAGATAGCTCCATATGCATACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-978s1c1
Sequence:CCGGGTATGGCCCAATCAACAACATCTCGAGATGTTGTTGATTGGGCCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-1102s1c1
Sequence:CCGGGTATTACACAATGGCCTCGTTCTCGAGAACGAGGCCATTGTGTAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024728.1-873s1c1
Sequence:CCGGCCTTCGGGTACACAATAGAAACTCGAGTTTCTATTGTGTACCCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-787s1c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-275s1c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1359s1c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1167s1c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024728
VALIDATED
C7orf10 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 10
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-1359s21c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-333s21c1
Sequence:CCGGTCTCAGTGTTAACCGAAATAACTCGAGTTATTTCGGTTAACACTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-787s21c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-275s21c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000336825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-1167s21c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-561s1c1
Sequence:CCGGCCTGTATGCATATGGAGCTATCTCGAGATAGCTCCATATGCATACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-978s1c1
Sequence:CCGGGTATGGCCCAATCAACAACATCTCGAGATGTTGTTGATTGGGCCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-1102s1c1
Sequence:CCGGGTATTACACAATGGCCTCGTTCTCGAGAACGAGGCCATTGTGTAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024728.1-873s1c1
Sequence:CCGGCCTTCGGGTACACAATAGAAACTCGAGTTTCTATTGTGTACCCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-787s1c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-275s1c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1359s1c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1167s1c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024728
VALIDATED
C7orf10 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 10
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-1359s21c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-333s21c1
Sequence:CCGGTCTCAGTGTTAACCGAAATAACTCGAGTTATTTCGGTTAACACTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-787s21c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024728.1-275s21c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000336825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024728.1-1167s21c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153987    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-561s1c1
Sequence:CCGGCCTGTATGCATATGGAGCTATCTCGAGATAGCTCCATATGCATACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152533    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-978s1c1
Sequence:CCGGGTATGGCCCAATCAACAACATCTCGAGATGTTGTTGATTGGGCCATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152629    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024728.1-1102s1c1
Sequence:CCGGGTATTACACAATGGCCTCGTTCTCGAGAACGAGGCCATTGTGTAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024728.1-873s1c1
Sequence:CCGGCCTTCGGGTACACAATAGAAACTCGAGTTTCTATTGTGTACCCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-787s1c1
Sequence:CCGGGCAGGAAATAACCAGCAGTTTCTCGAGAAACTGCTGGTTATTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-275s1c1
Sequence:CCGGCTGGTGATGATACACGAACTTCTCGAGAAGTTCGTGTATCATCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1359s1c1
Sequence:CCGGCGATCCGAATACACTGGCAAACTCGAGTTTGCCAGTGTATTCGGATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024728.1-1167s1c1
Sequence:CCGGCCCAGCTGTGAGATACAGTAACTCGAGTTACTGTATCTCACAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)