EMAIL THIS PAGE TO A FRIEND

C7orf25

chromosome 7 open reading frame 25

60 Gene Product Result for
Species: Human C7orf25(79020)
UniProtKB ID: Q9BPX7, A4D1V2, J3KR36, Q9H779
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024054 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024054 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024054 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043811 MISSION® esiRNA esiRNA human C7orf25 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099858 Rosetta Predictions human pricing
NM_024054 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321574 predicted 1434
2 SASI_Hs02_00321575 predicted 1170
3 SASI_Hs02_00321576 predicted 1305
4 SASI_Hs02_00321577 predicted 457
5 SASI_Hs02_00321578 predicted 394
6 SASI_Hs02_00321579 predicted 1232
7 SASI_Hs02_00321580 predicted 462
8 SASI_Hs02_00321581 predicted 1386
9 SASI_Hs02_00321582 predicted 740
10 SASI_Hs02_00321583 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024054 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00356503 predicted 1433
2 SASI_Hs01_00224143 predicted 1167
3 SASI_Hs01_00224147 predicted 1304
4 SASI_Hs02_00356504 predicted 453
5 SASI_Hs01_00224152 predicted 395
6 SASI_Hs02_00356505 predicted 1222
7 SASI_Hs02_00356506 predicted 462
8 SASI_Hs01_00224144 predicted 1378
9 SASI_Hs01_00224145 predicted 735
10 SASI_Hs01_00224146 predicted 1480
11 SASI_Hs01_00224148 predicted 346
12 SASI_Hs01_00224149 predicted 905
13 SASI_Hs01_00224150 predicted 229
14 SASI_Hs01_00224151 predicted 336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024054
C7orf25 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 25
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1489s1c1
Sequence:CCGGCCCATCTAAACTGGTGGGAAACTCGAGTTTCCCACCAGTTTAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-1356s1c1
Sequence:CCGGCAGAGCACTTACTGAGAGTAACTCGAGTTACTCTCAGTAAGTGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1653s1c1
Sequence:CCGGGAACCGAAATACGTCTATATACTCGAGTATATAGACGTATTTCGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-874s1c1
Sequence:CCGGCCAACAGAAATTAAGGTCGATCTCGAGATCGACCTTAATTTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-516s21c1
Sequence:CCGGAGTTGCAAATGGTGGTCATACCTCGAGGTATGACCACCATTTGCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-938s21c1
Sequence:CCGGATCTGGACATTACTACTTTAACTCGAGTTAAAGTAGTAATGTCCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-363s21c1
Sequence:CCGGAGCTATTAAAGAGTCTCATTTCTCGAGAAATGAGACTCTTTAATAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1339s21c1
Sequence:CCGGGCAAACAACCAGGGTGTTAAACTCGAGTTTAACACCCTGGTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1167s21c1
Sequence:CCGGGAGGGCCACTGTGTTAATTAACTCGAGTTAATTAACACAGTGGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024054
C7orf25 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 25
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1489s1c1
Sequence:CCGGCCCATCTAAACTGGTGGGAAACTCGAGTTTCCCACCAGTTTAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-1356s1c1
Sequence:CCGGCAGAGCACTTACTGAGAGTAACTCGAGTTACTCTCAGTAAGTGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1653s1c1
Sequence:CCGGGAACCGAAATACGTCTATATACTCGAGTATATAGACGTATTTCGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-874s1c1
Sequence:CCGGCCAACAGAAATTAAGGTCGATCTCGAGATCGACCTTAATTTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-516s21c1
Sequence:CCGGAGTTGCAAATGGTGGTCATACCTCGAGGTATGACCACCATTTGCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-938s21c1
Sequence:CCGGATCTGGACATTACTACTTTAACTCGAGTTAAAGTAGTAATGTCCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-363s21c1
Sequence:CCGGAGCTATTAAAGAGTCTCATTTCTCGAGAAATGAGACTCTTTAATAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1339s21c1
Sequence:CCGGGCAAACAACCAGGGTGTTAAACTCGAGTTTAACACCCTGGTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1167s21c1
Sequence:CCGGGAGGGCCACTGTGTTAATTAACTCGAGTTAATTAACACAGTGGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024054
C7orf25 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 25
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172759    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1489s1c1
Sequence:CCGGCCCATCTAAACTGGTGGGAAACTCGAGTTTCCCACCAGTTTAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168146    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-1356s1c1
Sequence:CCGGCAGAGCACTTACTGAGAGTAACTCGAGTTACTCTCAGTAAGTGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167584    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024054.1-1653s1c1
Sequence:CCGGGAACCGAAATACGTCTATATACTCGAGTATATAGACGTATTTCGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024054.1-874s1c1
Sequence:CCGGCCAACAGAAATTAAGGTCGATCTCGAGATCGACCTTAATTTCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-516s21c1
Sequence:CCGGAGTTGCAAATGGTGGTCATACCTCGAGGTATGACCACCATTTGCAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-938s21c1
Sequence:CCGGATCTGGACATTACTACTTTAACTCGAGTTAAAGTAGTAATGTCCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-363s21c1
Sequence:CCGGAGCTATTAAAGAGTCTCATTTCTCGAGAAATGAGACTCTTTAATAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1339s21c1
Sequence:CCGGGCAAACAACCAGGGTGTTAAACTCGAGTTTAACACCCTGGTTGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024054.2-1167s21c1
Sequence:CCGGGAGGGCCACTGTGTTAATTAACTCGAGTTAATTAACACAGTGGCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)