EMAIL THIS PAGE TO A FRIEND

C7orf26

chromosome 7 open reading frame 26

21 Gene Product Result for
UniProtKB ID: Q96N11, Q9BQ43
Gene ID:
chicken(416658) chromosome 14 open reading frame, human C7orf26
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024067 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024067 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024067 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094531 MISSION® esiRNA esiRNA human C7orf26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024067 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024067 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119107 predicted 1609
2 SASI_Hs01_00119108 predicted 945
3 SASI_Hs01_00119110 predicted 672
4 SASI_Hs02_00356527 predicted 585
5 SASI_Hs02_00356528 predicted 682
6 SASI_Hs01_00119112 predicted 634
7 SASI_Hs01_00119113 predicted 592
8 SASI_Hs02_00356529 predicted 566
9 SASI_Hs01_00119114 predicted 201
10 SASI_Hs01_00119115 predicted 433
11 SASI_Hs01_00119106 predicted 843
12 SASI_Hs01_00119109 predicted 427
13 SASI_Hs01_00119111 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024067
VALIDATED
C7orf26 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 26
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-1609s21c1
Sequence:CCGGGCCTCTGTTCTCTGCGCATTTCTCGAGAAATGCGCAGAGAACAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-676s21c1
Sequence:CCGGATTGCGGCCAATCTGCCAATACTCGAGTATTGGCAGATTGGCCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-262s21c1
Sequence:CCGGGACTCTGTTCGGCAGATTATTCTCGAGAATAATCTGCCGAACAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-594s21c1
Sequence:CCGGACCTATGGACTTGCTTGAAATCTCGAGATTTCAAGCAAGTCCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-493s21c1
Sequence:CCGGCAGACGCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-220s1c1
Sequence:CCGGCTTCTTGAAATCATGTGCAATCTCGAGATTGCACATGATTTCAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-1140s1c1
Sequence:CCGGCCATAATAACCTCCTCCAGCTCTCGAGAGCTGGAGGAGGTTATTATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-846s1c1
Sequence:CCGGCTCCCACCTCTTGTACTCAAACTCGAGTTTGAGTACAAGAGGTGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024067
VALIDATED
C7orf26 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 26
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-1609s21c1
Sequence:CCGGGCCTCTGTTCTCTGCGCATTTCTCGAGAAATGCGCAGAGAACAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-676s21c1
Sequence:CCGGATTGCGGCCAATCTGCCAATACTCGAGTATTGGCAGATTGGCCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-262s21c1
Sequence:CCGGGACTCTGTTCGGCAGATTATTCTCGAGAATAATCTGCCGAACAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-594s21c1
Sequence:CCGGACCTATGGACTTGCTTGAAATCTCGAGATTTCAAGCAAGTCCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-493s21c1
Sequence:CCGGCAGACGCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-220s1c1
Sequence:CCGGCTTCTTGAAATCATGTGCAATCTCGAGATTGCACATGATTTCAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-1140s1c1
Sequence:CCGGCCATAATAACCTCCTCCAGCTCTCGAGAGCTGGAGGAGGTTATTATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-846s1c1
Sequence:CCGGCTCCCACCTCTTGTACTCAAACTCGAGTTTGAGTACAAGAGGTGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024067
VALIDATED
C7orf26 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 26
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-1609s21c1
Sequence:CCGGGCCTCTGTTCTCTGCGCATTTCTCGAGAAATGCGCAGAGAACAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-676s21c1
Sequence:CCGGATTGCGGCCAATCTGCCAATACTCGAGTATTGGCAGATTGGCCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-262s21c1
Sequence:CCGGGACTCTGTTCGGCAGATTATTCTCGAGAATAATCTGCCGAACAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-594s21c1
Sequence:CCGGACCTATGGACTTGCTTGAAATCTCGAGATTTCAAGCAAGTCCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_024067.2-493s21c1
Sequence:CCGGCAGACGCTGAAGCAGATATTCCTCGAGGAATATCTGCTTCAGCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-220s1c1
Sequence:CCGGCTTCTTGAAATCATGTGCAATCTCGAGATTGCACATGATTTCAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-1140s1c1
Sequence:CCGGCCATAATAACCTCCTCCAGCTCTCGAGAGCTGGAGGAGGTTATTATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024067.2-846s1c1
Sequence:CCGGCTCCCACCTCTTGTACTCAAACTCGAGTTTGAGTACAAGAGGTGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)