EMAIL THIS PAGE TO A FRIEND

C7orf31

chromosome 7 open reading frame 31

57 Gene Product Result for
Species: Human C7orf31(136895)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138811 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054641 MISSION® esiRNA esiRNA human C7orf31 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138811 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047670 predicted 1166
2 SASI_Hs01_00047671 predicted 1809
3 SASI_Hs01_00047672 predicted 610
4 SASI_Hs02_00363974 predicted 2079
5 SASI_Hs01_00047673 predicted 700
6 SASI_Hs01_00047674 predicted 865
7 SASI_Hs01_00047675 predicted 2285
8 SASI_Hs01_00047677 predicted 820
9 SASI_Hs01_00047678 predicted 1665
10 SASI_Hs01_00047679 predicted 1147
11 SASI_Hs01_00047676 predicted 1632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138811
C7orf31 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 31
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-3088s1c1
Sequence:CCGGGCAAGAAAGGATGGCTTGGTACTCGAGTACCAAGCCATCCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-700s1c1
Sequence:CCGGCAGGAATTAAGGGAGTCACTTCTCGAGAAGTGACTCCCTTAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1146s1c1
Sequence:CCGGGAAGACAAGAGGTAATCCTTACTCGAGTAAGGATTACCTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-2009s1c1
Sequence:CCGGGCCTTAGTAAACCTAGTGTTTCTCGAGAAACACTAGGTTTACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-2683s1c1
Sequence:CCGGGCTGGAAAGAACTCAAATGATCTCGAGATCATTTGAGTTCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138811.3-2974s1c1
Sequence:CCGGGCTTACCCTTAACCTTCTGATCTCGAGATCAGAAGGTTAAGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1221s1c1
Sequence:CCGGGCCAGGTCAAGGTGTATATTACTCGAGTAATATACACCTTGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1586s21c1
Sequence:CCGGGACGTTCTCTGGAGGCTATAGCTCGAGCTATAGCCTCCAGAGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1481s21c1
Sequence:CCGGTAACACGAAAGATAGGATTTGCTCGAGCAAATCCTATCTTTCGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-752s21c1
Sequence:CCGGGAGAGTATGGTGGGATAATACCTCGAGGTATTATCCCACCATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1557s21c1
Sequence:CCGGAGGACGAATTGCCCGATTAATCTCGAGATTAATCGGGCAATTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138811
C7orf31 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 31
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-3088s1c1
Sequence:CCGGGCAAGAAAGGATGGCTTGGTACTCGAGTACCAAGCCATCCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-700s1c1
Sequence:CCGGCAGGAATTAAGGGAGTCACTTCTCGAGAAGTGACTCCCTTAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1146s1c1
Sequence:CCGGGAAGACAAGAGGTAATCCTTACTCGAGTAAGGATTACCTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-2009s1c1
Sequence:CCGGGCCTTAGTAAACCTAGTGTTTCTCGAGAAACACTAGGTTTACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-2683s1c1
Sequence:CCGGGCTGGAAAGAACTCAAATGATCTCGAGATCATTTGAGTTCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138811.3-2974s1c1
Sequence:CCGGGCTTACCCTTAACCTTCTGATCTCGAGATCAGAAGGTTAAGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1221s1c1
Sequence:CCGGGCCAGGTCAAGGTGTATATTACTCGAGTAATATACACCTTGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1586s21c1
Sequence:CCGGGACGTTCTCTGGAGGCTATAGCTCGAGCTATAGCCTCCAGAGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1481s21c1
Sequence:CCGGTAACACGAAAGATAGGATTTGCTCGAGCAAATCCTATCTTTCGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-752s21c1
Sequence:CCGGGAGAGTATGGTGGGATAATACCTCGAGGTATTATCCCACCATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1557s21c1
Sequence:CCGGAGGACGAATTGCCCGATTAATCTCGAGATTAATCGGGCAATTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138811
C7orf31 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 31
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138845    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-3088s1c1
Sequence:CCGGGCAAGAAAGGATGGCTTGGTACTCGAGTACCAAGCCATCCTTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-700s1c1
Sequence:CCGGCAGGAATTAAGGGAGTCACTTCTCGAGAAGTGACTCCCTTAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1146s1c1
Sequence:CCGGGAAGACAAGAGGTAATCCTTACTCGAGTAAGGATTACCTCTTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-2009s1c1
Sequence:CCGGGCCTTAGTAAACCTAGTGTTTCTCGAGAAACACTAGGTTTACTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138811.3-2683s1c1
Sequence:CCGGGCTGGAAAGAACTCAAATGATCTCGAGATCATTTGAGTTCTTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138811.3-2974s1c1
Sequence:CCGGGCTTACCCTTAACCTTCTGATCTCGAGATCAGAAGGTTAAGGGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138811.3-1221s1c1
Sequence:CCGGGCCAGGTCAAGGTGTATATTACTCGAGTAATATACACCTTGACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1586s21c1
Sequence:CCGGGACGTTCTCTGGAGGCTATAGCTCGAGCTATAGCCTCCAGAGAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1481s21c1
Sequence:CCGGTAACACGAAAGATAGGATTTGCTCGAGCAAATCCTATCTTTCGTGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-752s21c1
Sequence:CCGGGAGAGTATGGTGGGATAATACCTCGAGGTATTATCCCACCATACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138811.3-1557s21c1
Sequence:CCGGAGGACGAATTGCCCGATTAATCTCGAGATTAATCGGGCAATTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks