EMAIL THIS PAGE TO A FRIEND

C7orf34

chromosome 7 open reading frame 34

50 Gene Product Result for
Synonyms: ctm-1
Species: Human C7orf34(135927)
UniProtKB ID: Q96L11, A4D2H8, C9JTW1, Q8TDV6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178829 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178829 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178829 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178829 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178829 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369877 predicted 543
2 SASI_Hs01_00103327 predicted 387
3 SASI_Hs02_00369878 predicted 541
4 SASI_Hs01_00103328 predicted 428
5 SASI_Hs01_00103329 predicted 456
6 SASI_Hs01_00103330 predicted 441
7 SASI_Hs01_00103331 predicted 357
8 SASI_Hs01_00103333 predicted 433
9 SASI_Hs01_00103334 predicted 232
10 SASI_Hs01_00103335 predicted 237
11 SASI_Hs01_00103332 predicted 280
12 SASI_Hs01_00103336 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178829
C7orf34 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 34
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-464s1c1
Sequence:CCGGCAACTCTGCTTCATGCTCACTCTCGAGAGTGAGCATGAAGCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178829.2-553s1c1
Sequence:CCGGCCTCTGATCACCATCACTGTACTCGAGTACAGTGATGGTGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-446s1c1
Sequence:CCGGCGGACATTCCCAAATATCCAACTCGAGTTGGATATTTGGGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-257s1c1
Sequence:CCGGCAGAATCAAGAACAGTTCGAACTCGAGTTCGAACTGTTCTTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-448s1c1
Sequence:CCGGGACATTCCCAAATATCCAACTCTCGAGAGTTGGATATTTGGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-266s1c1
Sequence:CCGGGAACAGTTCGAAGAGCACTTTCTCGAGAAAGTGCTCTTCGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-445s1c1
Sequence:CCGGGCGGACATTCCCAAATATCCACTCGAGTGGATATTTGGGAATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-151s21c1
Sequence:CCGGTGTTCCTGGTTCCTATCTTGCCTCGAGGCAAGATAGGAACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-360s21c1
Sequence:CCGGGCTGTTCACAAGCACTCTTTCCTCGAGGAAAGAGTGCTTGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178829.4-578s21c1
Sequence:CCGGTCAGCAGCAGAGATACCAGTTCTCGAGAACTGGTATCTCTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178829
C7orf34 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 34
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-464s1c1
Sequence:CCGGCAACTCTGCTTCATGCTCACTCTCGAGAGTGAGCATGAAGCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178829.2-553s1c1
Sequence:CCGGCCTCTGATCACCATCACTGTACTCGAGTACAGTGATGGTGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-446s1c1
Sequence:CCGGCGGACATTCCCAAATATCCAACTCGAGTTGGATATTTGGGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-257s1c1
Sequence:CCGGCAGAATCAAGAACAGTTCGAACTCGAGTTCGAACTGTTCTTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-448s1c1
Sequence:CCGGGACATTCCCAAATATCCAACTCTCGAGAGTTGGATATTTGGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-266s1c1
Sequence:CCGGGAACAGTTCGAAGAGCACTTTCTCGAGAAAGTGCTCTTCGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-445s1c1
Sequence:CCGGGCGGACATTCCCAAATATCCACTCGAGTGGATATTTGGGAATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-151s21c1
Sequence:CCGGTGTTCCTGGTTCCTATCTTGCCTCGAGGCAAGATAGGAACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-360s21c1
Sequence:CCGGGCTGTTCACAAGCACTCTTTCCTCGAGGAAAGAGTGCTTGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178829.4-578s21c1
Sequence:CCGGTCAGCAGCAGAGATACCAGTTCTCGAGAACTGGTATCTCTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178829
C7orf34 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 34
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-464s1c1
Sequence:CCGGCAACTCTGCTTCATGCTCACTCTCGAGAGTGAGCATGAAGCAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166331    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178829.2-553s1c1
Sequence:CCGGCCTCTGATCACCATCACTGTACTCGAGTACAGTGATGGTGATCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-446s1c1
Sequence:CCGGCGGACATTCCCAAATATCCAACTCGAGTTGGATATTTGGGAATGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162573    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-257s1c1
Sequence:CCGGCAGAATCAAGAACAGTTCGAACTCGAGTTCGAACTGTTCTTGATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160918    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-448s1c1
Sequence:CCGGGACATTCCCAAATATCCAACTCTCGAGAGTTGGATATTTGGGAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-266s1c1
Sequence:CCGGGAACAGTTCGAAGAGCACTTTCTCGAGAAAGTGCTCTTCGAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178829.2-445s1c1
Sequence:CCGGGCGGACATTCCCAAATATCCACTCGAGTGGATATTTGGGAATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-151s21c1
Sequence:CCGGTGTTCCTGGTTCCTATCTTGCCTCGAGGCAAGATAGGAACCAGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178829.4-360s21c1
Sequence:CCGGGCTGTTCACAAGCACTCTTTCCTCGAGGAAAGAGTGCTTGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178829.4-578s21c1
Sequence:CCGGTCAGCAGCAGAGATACCAGTTCTCGAGAACTGGTATCTCTGCTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks