EMAIL THIS PAGE TO A FRIEND

C7orf41

chromosome 7 open reading frame 41

134 Gene Product Result for
Synonyms: Ells1
Species: Human C7orf41(222166)
UniProtKB ID: Q8N3F0, Q8N791, Q8N8M4, Q8NEX2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA029507 Anti-MTURN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152793 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152793 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152793 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU096841 MISSION® esiRNA esiRNA human C7orf41 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152793 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152793 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366741 predicted 1053
2 SASI_Hs01_00170739 predicted 920
3 SASI_Hs01_00170740 predicted 924
4 SASI_Hs01_00170741 predicted 860
5 SASI_Hs01_00170743 predicted 992
6 SASI_Hs01_00170744 predicted 668
7 SASI_Hs01_00170745 predicted 1027
8 SASI_Hs01_00170747 predicted 510
9 SASI_Hs01_00170748 predicted 900
10 SASI_Hs02_00366742 predicted 780
11 SASI_Hs01_00170742 predicted 672
12 SASI_Hs01_00170746 predicted 683
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152793
VALIDATED
C7orf41 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 41
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152793.2-279s21c1
Sequence:CCGGGACCGAACGCAGGATGGATTTCTCGAGAAATCCATCCTGCGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-676s21c1
Sequence:CCGGTTGCATTAGCACTTCGAAATACTCGAGTATTTCGAAGTGCTAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-706s21c1
Sequence:CCGGGCTCCCAGCATCCAAATTAAACTCGAGTTTAATTTGGATGCTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-870s21c1
Sequence:CCGGCTGACTATTCTCTTAAGTTTACTCGAGTAAACTTAAGAGAATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-138s1c1
Sequence:CCGGGATGATGAACAGAGCAGGTGACTCGAGTCACCTGCTCTGTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152793.1-206s1c1
Sequence:CCGGCACAGGATTACATCTCCTCCTCTCGAGAGGAGGAGATGTAATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152793.1-198s1c1
Sequence:CCGGGCAGCTAGCACAGGATTACATCTCGAGATGTAATCCTGTGCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1246s1c1
Sequence:CCGGCCGCTTAAACTTTGAAGCCATCTCGAGATGGCTTCAAAGTTTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1679s1c1
Sequence:CCGGCCTCCTTTACAACACTAGATTCTCGAGAATCTAGTGTTGTAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-298s1c1
Sequence:CCGGGATGCAGATGACGATGCGTTTCTCGAGAAACGCATCGTCATCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152793
VALIDATED
C7orf41 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 41
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152793.2-279s21c1
Sequence:CCGGGACCGAACGCAGGATGGATTTCTCGAGAAATCCATCCTGCGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-676s21c1
Sequence:CCGGTTGCATTAGCACTTCGAAATACTCGAGTATTTCGAAGTGCTAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-706s21c1
Sequence:CCGGGCTCCCAGCATCCAAATTAAACTCGAGTTTAATTTGGATGCTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-870s21c1
Sequence:CCGGCTGACTATTCTCTTAAGTTTACTCGAGTAAACTTAAGAGAATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-138s1c1
Sequence:CCGGGATGATGAACAGAGCAGGTGACTCGAGTCACCTGCTCTGTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152793.1-206s1c1
Sequence:CCGGCACAGGATTACATCTCCTCCTCTCGAGAGGAGGAGATGTAATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152793.1-198s1c1
Sequence:CCGGGCAGCTAGCACAGGATTACATCTCGAGATGTAATCCTGTGCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1246s1c1
Sequence:CCGGCCGCTTAAACTTTGAAGCCATCTCGAGATGGCTTCAAAGTTTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1679s1c1
Sequence:CCGGCCTCCTTTACAACACTAGATTCTCGAGAATCTAGTGTTGTAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-298s1c1
Sequence:CCGGGATGCAGATGACGATGCGTTTCTCGAGAAACGCATCGTCATCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152793
VALIDATED
C7orf41 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 41
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152793.2-279s21c1
Sequence:CCGGGACCGAACGCAGGATGGATTTCTCGAGAAATCCATCCTGCGTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425116    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-676s21c1
Sequence:CCGGTTGCATTAGCACTTCGAAATACTCGAGTATTTCGAAGTGCTAATGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422922    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-706s21c1
Sequence:CCGGGCTCCCAGCATCCAAATTAAACTCGAGTTTAATTTGGATGCTGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424425    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152793.2-870s21c1
Sequence:CCGGCTGACTATTCTCTTAAGTTTACTCGAGTAAACTTAAGAGAATAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-138s1c1
Sequence:CCGGGATGATGAACAGAGCAGGTGACTCGAGTCACCTGCTCTGTTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_152793.1-206s1c1
Sequence:CCGGCACAGGATTACATCTCCTCCTCTCGAGAGGAGGAGATGTAATCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152793.1-198s1c1
Sequence:CCGGGCAGCTAGCACAGGATTACATCTCGAGATGTAATCCTGTGCTAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1246s1c1
Sequence:CCGGCCGCTTAAACTTTGAAGCCATCTCGAGATGGCTTCAAAGTTTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152793.1-1679s1c1
Sequence:CCGGCCTCCTTTACAACACTAGATTCTCGAGAATCTAGTGTTGTAAAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152793.1-298s1c1
Sequence:CCGGGATGCAGATGACGATGCGTTTCTCGAGAAACGCATCGTCATCTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks