EMAIL THIS PAGE TO A FRIEND

C7orf43

chromosome 7 open reading frame 43

Species: Human C7orf43(55262)
UniProtKB ID: Q8WVR3, A4D2A9, D6W5U4, Q9BQJ1, Q9BUB6, Q9NV47
Gene ID:
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018275 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072851 MISSION® esiRNA esiRNA human C7orf43 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018275 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214171 predicted 1284
2 SASI_Hs01_00214172 predicted 1005
3 SASI_Hs01_00214174 predicted 951
4 SASI_Hs02_00351648 predicted 928
5 SASI_Hs01_00214175 predicted 924
6 SASI_Hs01_00214177 predicted 1266
7 SASI_Hs02_00351649 predicted 965
8 SASI_Hs01_00214179 predicted 734
9 SASI_Hs02_00351650 predicted 1314
10 SASI_Hs02_00351651 predicted 1103
11 SASI_Hs01_00214173 predicted 1577
12 SASI_Hs01_00214176 predicted 1778
13 SASI_Hs01_00214178 predicted 1922
14 SASI_Hs01_00214180 predicted 1754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018275
C7orf43 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 43
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-604s1c1
Sequence:CCGGGAACCGATTGTGTCCACAGATCTCGAGATCTGTGGACACAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-958s1c1
Sequence:CCGGCCCAACTTCAACGCCAGTTATCTCGAGATAACTGGCGTTGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-1111s1c1
Sequence:CCGGGAGGAACACAACTTCCTGTTTCTCGAGAAACAGGAAGTTGTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018275.3-2213s1c1
Sequence:CCGGCCCTGGTTCTGAGTTTACAAACTCGAGTTTGTAAACTCAGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-1858s1c1
Sequence:CCGGGTGTTGTCTCTGGACAAGATTCTCGAGAATCTTGTCCAGAGACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018275.3-2405s1c1
Sequence:CCGGCAGCCTGAAGCACTTTAATTTCTCGAGAAATTAAAGTGCTTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-615s1c1
Sequence:CCGGGTCCACAGATGAGGTCATCTTCTCGAGAAGATGACCTCATCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-925s1c1
Sequence:CCGGGAGGAAATCTCCATCTGGGATCTCGAGATCCCAGATGGAGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018275
C7orf43 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 43
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-604s1c1
Sequence:CCGGGAACCGATTGTGTCCACAGATCTCGAGATCTGTGGACACAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-958s1c1
Sequence:CCGGCCCAACTTCAACGCCAGTTATCTCGAGATAACTGGCGTTGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-1111s1c1
Sequence:CCGGGAGGAACACAACTTCCTGTTTCTCGAGAAACAGGAAGTTGTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018275.3-2213s1c1
Sequence:CCGGCCCTGGTTCTGAGTTTACAAACTCGAGTTTGTAAACTCAGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-1858s1c1
Sequence:CCGGGTGTTGTCTCTGGACAAGATTCTCGAGAATCTTGTCCAGAGACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018275.3-2405s1c1
Sequence:CCGGCAGCCTGAAGCACTTTAATTTCTCGAGAAATTAAAGTGCTTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-615s1c1
Sequence:CCGGGTCCACAGATGAGGTCATCTTCTCGAGAAGATGACCTCATCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-925s1c1
Sequence:CCGGGAGGAAATCTCCATCTGGGATCTCGAGATCCCAGATGGAGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018275
C7orf43 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 43
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-604s1c1
Sequence:CCGGGAACCGATTGTGTCCACAGATCTCGAGATCTGTGGACACAATCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-958s1c1
Sequence:CCGGCCCAACTTCAACGCCAGTTATCTCGAGATAACTGGCGTTGAAGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-1111s1c1
Sequence:CCGGGAGGAACACAACTTCCTGTTTCTCGAGAAACAGGAAGTTGTGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127657    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018275.3-2213s1c1
Sequence:CCGGCCCTGGTTCTGAGTTTACAAACTCGAGTTTGTAAACTCAGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-1858s1c1
Sequence:CCGGGTGTTGTCTCTGGACAAGATTCTCGAGAATCTTGTCCAGAGACAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130091    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018275.3-2405s1c1
Sequence:CCGGCAGCCTGAAGCACTTTAATTTCTCGAGAAATTAAAGTGCTTCAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018275.3-615s1c1
Sequence:CCGGGTCCACAGATGAGGTCATCTTCTCGAGAAGATGACCTCATCTGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018275.3-925s1c1
Sequence:CCGGGAGGAAATCTCCATCTGGGATCTCGAGATCCCAGATGGAGATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks