EMAIL THIS PAGE TO A FRIEND

C7orf49

chromosome 7 open reading frame 49

19 Gene Product Result for
Synonyms: MRI
Species: Human C7orf49(78996)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024033 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064051 MISSION® esiRNA esiRNA human C7orf49 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024033 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103694 predicted 988
2 SASI_Hs01_00103695 predicted 872
3 SASI_Hs01_00103696 predicted 951
4 SASI_Hs01_00103697 predicted 329
5 SASI_Hs02_00356458 predicted 506
6 SASI_Hs01_00103698 predicted 938
7 SASI_Hs01_00103700 predicted 363
8 SASI_Hs01_00103702 predicted 971
9 SASI_Hs01_00103703 predicted 376
10 SASI_Hs02_00356459 predicted 1115
11 SASI_Hs01_00103699 predicted 945
12 SASI_Hs01_00103701 predicted 354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024033
VALIDATED
C7orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 49
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-879s1c1
Sequence:CCGGCCCATTTGACTCCCTCTGTATCTCGAGATACAGAGGGAGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-346s1c1
Sequence:CCGGGCATGAATGAGGCTGAGATAGCTCGAGCTATCTCAGCCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1217s1c1
Sequence:CCGGGCCACAGTGTATAGACTGGTACTCGAGTACCAGTCTATACACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-344s1c1
Sequence:CCGGCTGCATGAATGAGGCTGAGATCTCGAGATCTCAGCCTCATTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-360s1c1
Sequence:CCGGGAGATAGTTGATGTTGCTCTGCTCGAGCAGAGCAACATCAACTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1053s1c1
Sequence:CCGGGCACTGGAATTGCTACAGTTTCTCGAGAAACTGTAGCAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-612s1c1
Sequence:CCGGGAAGAGGATGTGCTGAAATACCTCGAGGTATTTCAGCACATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-357s1c1
Sequence:CCGGGCTGAGATAGTTGATGTTGCTCTCGAGAGCAACATCAACTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-376s1c1
Sequence:CCGGCTCTGGGAATCCTGATTGAGACTCGAGTCTCAATCAGGATTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-626s1c1
Sequence:CCGGGAAATACGTCCGGGAGATCTTCTCGAGAAGATCTCCCGGACGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-609s1c1
Sequence:CCGGGAGGAAGAGGATGTGCTGAAACTCGAGTTTCAGCACATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024033
VALIDATED
C7orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 49
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-879s1c1
Sequence:CCGGCCCATTTGACTCCCTCTGTATCTCGAGATACAGAGGGAGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-346s1c1
Sequence:CCGGGCATGAATGAGGCTGAGATAGCTCGAGCTATCTCAGCCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1217s1c1
Sequence:CCGGGCCACAGTGTATAGACTGGTACTCGAGTACCAGTCTATACACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-344s1c1
Sequence:CCGGCTGCATGAATGAGGCTGAGATCTCGAGATCTCAGCCTCATTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-360s1c1
Sequence:CCGGGAGATAGTTGATGTTGCTCTGCTCGAGCAGAGCAACATCAACTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1053s1c1
Sequence:CCGGGCACTGGAATTGCTACAGTTTCTCGAGAAACTGTAGCAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-612s1c1
Sequence:CCGGGAAGAGGATGTGCTGAAATACCTCGAGGTATTTCAGCACATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-357s1c1
Sequence:CCGGGCTGAGATAGTTGATGTTGCTCTCGAGAGCAACATCAACTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-376s1c1
Sequence:CCGGCTCTGGGAATCCTGATTGAGACTCGAGTCTCAATCAGGATTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-626s1c1
Sequence:CCGGGAAATACGTCCGGGAGATCTTCTCGAGAAGATCTCCCGGACGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-609s1c1
Sequence:CCGGGAGGAAGAGGATGTGCTGAAACTCGAGTTTCAGCACATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024033
VALIDATED
C7orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 49
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-879s1c1
Sequence:CCGGCCCATTTGACTCCCTCTGTATCTCGAGATACAGAGGGAGTCAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-346s1c1
Sequence:CCGGGCATGAATGAGGCTGAGATAGCTCGAGCTATCTCAGCCTCATTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165894    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1217s1c1
Sequence:CCGGGCCACAGTGTATAGACTGGTACTCGAGTACCAGTCTATACACTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-344s1c1
Sequence:CCGGCTGCATGAATGAGGCTGAGATCTCGAGATCTCAGCCTCATTCATGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-360s1c1
Sequence:CCGGGAGATAGTTGATGTTGCTCTGCTCGAGCAGAGCAACATCAACTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163314    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024033.1-1053s1c1
Sequence:CCGGGCACTGGAATTGCTACAGTTTCTCGAGAAACTGTAGCAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-612s1c1
Sequence:CCGGGAAGAGGATGTGCTGAAATACCTCGAGGTATTTCAGCACATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-357s1c1
Sequence:CCGGGCTGAGATAGTTGATGTTGCTCTCGAGAGCAACATCAACTATCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024033.1-376s1c1
Sequence:CCGGCTCTGGGAATCCTGATTGAGACTCGAGTCTCAATCAGGATTCCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-626s1c1
Sequence:CCGGGAAATACGTCCGGGAGATCTTCTCGAGAAGATCTCCCGGACGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024033.1-609s1c1
Sequence:CCGGGAGGAAGAGGATGTGCTGAAACTCGAGTTTCAGCACATCCTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks