EMAIL THIS PAGE TO A FRIEND

C7orf50

chromosome 7 open reading frame 50

20 Gene Product Result for
Synonyms: YCR016W
UniProtKB ID: Q9BRJ6
Gene ID:
chicken(416455) chromosome 14 open reading frame, human C7orf50
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092351 MISSION® esiRNA esiRNA human C7orf50 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032350 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228865 predicted 1790
2 SASI_Hs01_00228866 predicted 1591
3 SASI_Hs01_00228867 predicted 1789
4 SASI_Hs01_00228868 predicted 1286
5 SASI_Hs01_00228869 predicted 1796
6 SASI_Hs01_00228870 predicted 1698
7 SASI_Hs01_00228871 predicted 1212
8 SASI_Hs01_00228872 predicted 1296
9 SASI_Hs02_00359739 predicted 1093
10 SASI_Hs01_00228873 predicted 1228
11 SASI_Hs01_00228874 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032350
VALIDATED
C7orf50 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 50
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032350.3-1284s1c1
Sequence:CCGGGCACATGTATGACAGTGACAACTCGAGTTGTCACTGTCATACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-967s21c1
Sequence:CCGGATCTGCTTTGGAGGGAAATGTCTCGAGACATTTCCCTCCAAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-443s21c1
Sequence:CCGGTGGCTCCTGCTGCACATGTATCTCGAGATACATGTGCAGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-906s21c1
Sequence:CCGGAGCGTGGATGCTCTGGAATCACTCGAGTGATTCCAGAGCATCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-406s21c1
Sequence:CCGGGCACAAGAACTGGAGGTTTCACTCGAGTGAAACCTCCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-467s21c1
Sequence:CCGGAGTGACAAGGTTCCCGATGAGCTCGAGCTCATCGGGAACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-263s21c1
Sequence:CCGGGTCCTGGAAAGGAAGCTGAAACTCGAGTTTCAGCTTCCTTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-643s21c1
Sequence:CCGGGCTGCTCTCCTAGTGGGTTCACTCGAGTGAACCCACTAGGAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-455s21c1
Sequence:CCGGCACATGTATGACAGTGACAAGCTCGAGCTTGTCACTGTCATACATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032350
VALIDATED
C7orf50 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 50
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032350.3-1284s1c1
Sequence:CCGGGCACATGTATGACAGTGACAACTCGAGTTGTCACTGTCATACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-967s21c1
Sequence:CCGGATCTGCTTTGGAGGGAAATGTCTCGAGACATTTCCCTCCAAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-443s21c1
Sequence:CCGGTGGCTCCTGCTGCACATGTATCTCGAGATACATGTGCAGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-906s21c1
Sequence:CCGGAGCGTGGATGCTCTGGAATCACTCGAGTGATTCCAGAGCATCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-406s21c1
Sequence:CCGGGCACAAGAACTGGAGGTTTCACTCGAGTGAAACCTCCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-467s21c1
Sequence:CCGGAGTGACAAGGTTCCCGATGAGCTCGAGCTCATCGGGAACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-263s21c1
Sequence:CCGGGTCCTGGAAAGGAAGCTGAAACTCGAGTTTCAGCTTCCTTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-643s21c1
Sequence:CCGGGCTGCTCTCCTAGTGGGTTCACTCGAGTGAACCCACTAGGAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-455s21c1
Sequence:CCGGCACATGTATGACAGTGACAAGCTCGAGCTTGTCACTGTCATACATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032350
VALIDATED
C7orf50 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 50
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032350.3-1284s1c1
Sequence:CCGGGCACATGTATGACAGTGACAACTCGAGTTGTCACTGTCATACATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369564    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-967s21c1
Sequence:CCGGATCTGCTTTGGAGGGAAATGTCTCGAGACATTTCCCTCCAAAGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-443s21c1
Sequence:CCGGTGGCTCCTGCTGCACATGTATCTCGAGATACATGTGCAGCAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032350.5-906s21c1
Sequence:CCGGAGCGTGGATGCTCTGGAATCACTCGAGTGATTCCAGAGCATCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-406s21c1
Sequence:CCGGGCACAAGAACTGGAGGTTTCACTCGAGTGAAACCTCCAGTTCTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-467s21c1
Sequence:CCGGAGTGACAAGGTTCCCGATGAGCTCGAGCTCATCGGGAACCTTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_032350.5-263s21c1
Sequence:CCGGGTCCTGGAAAGGAAGCTGAAACTCGAGTTTCAGCTTCCTTTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-643s21c1
Sequence:CCGGGCTGCTCTCCTAGTGGGTTCACTCGAGTGAACCCACTAGGAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032350.5-455s21c1
Sequence:CCGGCACATGTATGACAGTGACAAGCTCGAGCTTGTCACTGTCATACATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks