EMAIL THIS PAGE TO A FRIEND

C7orf55

chromosome 7 open reading frame 55

Synonyms: FMC1
UniProtKB ID: Q96HJ9, B7Z4Q3, Q75M90, Q9P0B3
Gene ID:
chicken(770530) chromosome 1 open reading frame, human C7orf55
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_197964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_197964 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_197964 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200986 predicted 340
2 SASI_Hs02_00371570 predicted 358
3 SASI_Hs02_00371571 predicted 328
4 SASI_Hs01_00200977 predicted 389
5 SASI_Hs02_00371572 predicted 322
6 SASI_Hs01_00200979 predicted 390
7 SASI_Hs02_00371573 predicted 338
8 SASI_Hs01_00200981 predicted 392
9 SASI_Hs02_00371574 predicted 332
10 SASI_Hs02_00371575 predicted 357
11 SASI_Hs01_00200978 predicted 212
12 SASI_Hs01_00200980 predicted 229
13 SASI_Hs01_00200982 predicted 221
14 SASI_Hs01_00200983 predicted 232
15 SASI_Hs01_00200984 predicted 205
16 SASI_Hs01_00200985 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197964
VALIDATED
C7orf55 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 55
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197964.3-601s21c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-466s21c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-403s21c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-456s21c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-297s1c1
Sequence:CCGGCAGGAATTTCATGGCAAGGGTCTCGAGACCCTTGCCATGAAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-285s1c1
Sequence:CCGGGTGGCCCTACATCAGGAATTTCTCGAGAAATTCCTGATGTAGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-278s1c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-294s1c1
Sequence:CCGGCATCAGGAATTTCATGGCAAGCTCGAGCTTGCCATGAAATTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-423s1c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-222s1c1
Sequence:CCGGCAACATGAGCTTCATTTCCAACTCGAGTTGGAAATGAAGCTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-417s1c1
Sequence:CCGGGATGCTGCATTCATAGGAGAACTCGAGTTCTCCTATGAATGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-288s1c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-225s1c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-221s1c1
Sequence:CCGGCCAACATGAGCTTCATTTCCACTCGAGTGGAAATGAAGCTCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-300s1c1
Sequence:CCGGGAATTTCATGGCAAGGGTGAGCTCGAGCTCACCCTTGCCATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197964
VALIDATED
C7orf55 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 55
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197964.3-601s21c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-466s21c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-403s21c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-456s21c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-297s1c1
Sequence:CCGGCAGGAATTTCATGGCAAGGGTCTCGAGACCCTTGCCATGAAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-285s1c1
Sequence:CCGGGTGGCCCTACATCAGGAATTTCTCGAGAAATTCCTGATGTAGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-278s1c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-294s1c1
Sequence:CCGGCATCAGGAATTTCATGGCAAGCTCGAGCTTGCCATGAAATTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-423s1c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-222s1c1
Sequence:CCGGCAACATGAGCTTCATTTCCAACTCGAGTTGGAAATGAAGCTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-417s1c1
Sequence:CCGGGATGCTGCATTCATAGGAGAACTCGAGTTCTCCTATGAATGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-288s1c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-225s1c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-221s1c1
Sequence:CCGGCCAACATGAGCTTCATTTCCACTCGAGTGGAAATGAAGCTCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-300s1c1
Sequence:CCGGGAATTTCATGGCAAGGGTGAGCTCGAGCTCACCCTTGCCATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197964
VALIDATED
C7orf55 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 55
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330663    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197964.3-601s21c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-466s21c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-403s21c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197964.3-456s21c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-297s1c1
Sequence:CCGGCAGGAATTTCATGGCAAGGGTCTCGAGACCCTTGCCATGAAATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-285s1c1
Sequence:CCGGGTGGCCCTACATCAGGAATTTCTCGAGAAATTCCTGATGTAGGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-278s1c1
Sequence:CCGGGAAACATGTGGCCCTACATCACTCGAGTGATGTAGGGCCACATGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-294s1c1
Sequence:CCGGCATCAGGAATTTCATGGCAAGCTCGAGCTTGCCATGAAATTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159440    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-423s1c1
Sequence:CCGGGCATTCATAGGAGAATTGAATCTCGAGATTCAATTCTCCTATGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-222s1c1
Sequence:CCGGCAACATGAGCTTCATTTCCAACTCGAGTTGGAAATGAAGCTCATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163380    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-417s1c1
Sequence:CCGGGATGCTGCATTCATAGGAGAACTCGAGTTCTCCTATGAATGCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-288s1c1
Sequence:CCGGGCCCTACATCAGGAATTTCATCTCGAGATGAAATTCCTGATGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-225s1c1
Sequence:CCGGCATGAGCTTCATTTCCAAGCTCTCGAGAGCTTGGAAATGAAGCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_197964.1-221s1c1
Sequence:CCGGCCAACATGAGCTTCATTTCCACTCGAGTGGAAATGAAGCTCATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197964.1-300s1c1
Sequence:CCGGGAATTTCATGGCAAGGGTGAGCTCGAGCTCACCCTTGCCATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks