EMAIL THIS PAGE TO A FRIEND

C7orf57

chromosome 7 open reading frame 57

25 Gene Product Result for
UniProtKB ID: Q8NEG2, C9JBJ8
Gene ID:
chicken(420941) chromosome 2 open reading frame, human C7orf57
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_374435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001100159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100159 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU099571 MISSION® esiRNA esiRNA human C7orf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100159 Rosetta Predictions human pricing
XM_059832 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321724 predicted 1162
2 SASI_Hs02_00321725 predicted 1106
3 SASI_Hs02_00321726 predicted 1548
4 SASI_Hs02_00321727 predicted 1421
5 SASI_Hs02_00321728 predicted 1232
6 SASI_Hs02_00321729 predicted 447
7 SASI_Hs02_00321730 predicted 1145
8 SASI_Hs02_00321731 predicted 276
9 SASI_Hs02_00321732 predicted 1374
10 SASI_Hs02_00321733 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_059832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295980 predicted 1377
2 SASI_Hs01_00295981 predicted 1314
3 SASI_Hs01_00295982 predicted 1368
4 SASI_Hs01_00295983 predicted 1438
5 SASI_Hs01_00295984 predicted 656
6 SASI_Hs01_00295985 predicted 1359
7 SASI_Hs01_00295986 predicted 497
8 SASI_Hs01_00295987 predicted 1589
9 SASI_Hs01_00295988 predicted 1272
10 SASI_Hs01_00295989 predicted 1064
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374435
C7orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 57
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-276s1c1
Sequence:CCGGGATTGGTATTACCACGTCCCACTCGAGTGGGACGTGGTAATACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-624s1c1
Sequence:CCGGGATCAAGCCAATGGTAGCTATCTCGAGATAGCTACCATTGGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-874s1c1
Sequence:CCGGGCAATGGTTATAAGGATGAGTCTCGAGACTCATCCTTATAACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-426s1c1
Sequence:CCGGGAATATGTGAAGCTCTCGAAACTCGAGTTTCGAGAGCTTCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-591s1c1
Sequence:CCGGCTGGATTACATGGTTCATGAACTCGAGTTCATGAACCATGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374435
C7orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 57
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-276s1c1
Sequence:CCGGGATTGGTATTACCACGTCCCACTCGAGTGGGACGTGGTAATACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-624s1c1
Sequence:CCGGGATCAAGCCAATGGTAGCTATCTCGAGATAGCTACCATTGGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-874s1c1
Sequence:CCGGGCAATGGTTATAAGGATGAGTCTCGAGACTCATCCTTATAACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-426s1c1
Sequence:CCGGGAATATGTGAAGCTCTCGAAACTCGAGTTTCGAGAGCTTCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-591s1c1
Sequence:CCGGCTGGATTACATGGTTCATGAACTCGAGTTCATGAACCATGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374435
C7orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 57
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-276s1c1
Sequence:CCGGGATTGGTATTACCACGTCCCACTCGAGTGGGACGTGGTAATACCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-624s1c1
Sequence:CCGGGATCAAGCCAATGGTAGCTATCTCGAGATAGCTACCATTGGCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-874s1c1
Sequence:CCGGGCAATGGTTATAAGGATGAGTCTCGAGACTCATCCTTATAACCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-426s1c1
Sequence:CCGGGAATATGTGAAGCTCTCGAAACTCGAGTTTCGAGAGCTTCACATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374435.2-591s1c1
Sequence:CCGGCTGGATTACATGGTTCATGAACTCGAGTTCATGAACCATGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100159
C7orf57 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 57
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000440005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100159.1-580s21c1
Sequence:CCGGTGCCGGATTACATGGTTCATGCTCGAGCATGAACCATGTAATCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100159.1-1541s21c1
Sequence:CCGGGAATATGGTGATACAGTTTATCTCGAGATAAACTGTATCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100159
C7orf57 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 57
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000440005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100159.1-580s21c1
Sequence:CCGGTGCCGGATTACATGGTTCATGCTCGAGCATGAACCATGTAATCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100159.1-1541s21c1
Sequence:CCGGGAATATGGTGATACAGTTTATCTCGAGATAAACTGTATCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100159
C7orf57 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 57
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000440005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100159.1-580s21c1
Sequence:CCGGTGCCGGATTACATGGTTCATGCTCGAGCATGAACCATGTAATCCGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100159.1-1541s21c1
Sequence:CCGGGAATATGGTGATACAGTTTATCTCGAGATAAACTGTATCACCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks