EMAIL THIS PAGE TO A FRIEND

C7orf60

chromosome 7 open reading frame 60

190 Gene Product Result for
Species: Human C7orf60(154743)
UniProtKB ID: Q1RMZ1, Q8N3D0, Q96MV7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152556 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152556 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094791 predicted 335
2 SASI_Hs02_00366368 predicted 517
3 SASI_Hs02_00366369 predicted 676
4 SASI_Hs01_00094793 predicted 500
5 SASI_Hs02_00366370 predicted 407
6 SASI_Hs01_00094795 predicted 950
7 SASI_Hs01_00094797 predicted 923
8 SASI_Hs01_00094798 predicted 738
9 SASI_Hs01_00094799 predicted 640
10 SASI_Hs02_00366371 predicted 706
11 SASI_Hs01_00094792 predicted 933
12 SASI_Hs01_00094794 predicted 603
13 SASI_Hs01_00094796 predicted 575
14 SASI_Hs01_00094800 predicted 574
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152556
VALIDATED
C7orf60 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 60
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-314s1c1
Sequence:CCGGGAACACTGTGAGGATGAAGAACTCGAGTTCTTCATCCTCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-408s1c1
Sequence:CCGGGTCGTATTGAATGGTGTTGTACTCGAGTACAACACCATTCAATACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152556.1-521s1c1
Sequence:CCGGGCCTTAAATATGCATGAGTCTCTCGAGAGACTCATGCATATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-737s1c1
Sequence:CCGGCTGAACTTACAGCTTCAGCAACTCGAGTTGCTGAAGCTGTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-2767s1c1
Sequence:CCGGGCACTTCTTTACTCTGGTAAACTCGAGTTTACCAGAGTAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-557s1c1
Sequence:CCGGCATTTAACCAACCTCAGCTTTCTCGAGAAAGCTGAGGTTGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152556
VALIDATED
C7orf60 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 60
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-314s1c1
Sequence:CCGGGAACACTGTGAGGATGAAGAACTCGAGTTCTTCATCCTCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-408s1c1
Sequence:CCGGGTCGTATTGAATGGTGTTGTACTCGAGTACAACACCATTCAATACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152556.1-521s1c1
Sequence:CCGGGCCTTAAATATGCATGAGTCTCTCGAGAGACTCATGCATATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-737s1c1
Sequence:CCGGCTGAACTTACAGCTTCAGCAACTCGAGTTGCTGAAGCTGTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-2767s1c1
Sequence:CCGGGCACTTCTTTACTCTGGTAAACTCGAGTTTACCAGAGTAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-557s1c1
Sequence:CCGGCATTTAACCAACCTCAGCTTTCTCGAGAAAGCTGAGGTTGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152556
VALIDATED
C7orf60 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 60
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-314s1c1
Sequence:CCGGGAACACTGTGAGGATGAAGAACTCGAGTTCTTCATCCTCACAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-408s1c1
Sequence:CCGGGTCGTATTGAATGGTGTTGTACTCGAGTACAACACCATTCAATACGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152556.1-521s1c1
Sequence:CCGGGCCTTAAATATGCATGAGTCTCTCGAGAGACTCATGCATATTTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-737s1c1
Sequence:CCGGCTGAACTTACAGCTTCAGCAACTCGAGTTGCTGAAGCTGTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_152556.1-2767s1c1
Sequence:CCGGGCACTTCTTTACTCTGGTAAACTCGAGTTTACCAGAGTAAAGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152556.1-557s1c1
Sequence:CCGGCATTTAACCAACCTCAGCTTTCTCGAGAAAGCTGAGGTTGGTTAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks