EMAIL THIS PAGE TO A FRIEND

C7orf61

chromosome 7 open reading frame 61

20 Gene Product Result for
Species: Human C7orf61(402573)
UniProtKB ID: Q8IZ16
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004323 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU034041 MISSION® esiRNA esiRNA human C7orf61 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004323 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304539 predicted 635
2 SASI_Hs01_00201737 predicted 526
3 SASI_Hs01_00201738 predicted 484
4 SASI_Hs01_00201739 predicted 702
5 SASI_Hs01_00201740 predicted 412
6 SASI_Hs01_00201741 predicted 439
7 SASI_Hs01_00201742 predicted 398
8 SASI_Hs01_00201743 predicted 694
9 SASI_Hs01_00201744 predicted 479
10 SASI_Hs01_00201745 predicted 718
11 SASI_Hs01_00201746 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004323
C7orf61 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 61
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-291s1c1
Sequence:CCGGGCAAAGGATTATTTCCTGGGTCTCGAGACCCAGGAAATAATCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-292s1c1
Sequence:CCGGCAAAGGATTATTTCCTGGGTTCTCGAGAACCCAGGAAATAATCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-363s1c1
Sequence:CCGGCAAGAAACACTCATTGAAGAACTCGAGTTCTTCAATGAGTGTTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-366s1c1
Sequence:CCGGGAAACACTCATTGAAGAAGATCTCGAGATCTTCTTCAATGAGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-626s1c1
Sequence:CCGGGCTGGAAGTCATCAGTGAGTTCTCGAGAACTCACTGATGACTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004323.1-405s21c1
Sequence:CCGGGGTTGAGACTTTGAGGTTGGTCTCGAGACCAACCTCAAAGTCTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004323.1-973s21c1
Sequence:CCGGTGGGAAATAAATATCAGATAGCTCGAGCTATCTGATATTTATTTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004323
C7orf61 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 61
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-291s1c1
Sequence:CCGGGCAAAGGATTATTTCCTGGGTCTCGAGACCCAGGAAATAATCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-292s1c1
Sequence:CCGGCAAAGGATTATTTCCTGGGTTCTCGAGAACCCAGGAAATAATCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-363s1c1
Sequence:CCGGCAAGAAACACTCATTGAAGAACTCGAGTTCTTCAATGAGTGTTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-366s1c1
Sequence:CCGGGAAACACTCATTGAAGAAGATCTCGAGATCTTCTTCAATGAGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-626s1c1
Sequence:CCGGGCTGGAAGTCATCAGTGAGTTCTCGAGAACTCACTGATGACTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004323.1-405s21c1
Sequence:CCGGGGTTGAGACTTTGAGGTTGGTCTCGAGACCAACCTCAAAGTCTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004323.1-973s21c1
Sequence:CCGGTGGGAAATAAATATCAGATAGCTCGAGCTATCTGATATTTATTTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004323
C7orf61 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 61
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168484    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-291s1c1
Sequence:CCGGGCAAAGGATTATTTCCTGGGTCTCGAGACCCAGGAAATAATCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-292s1c1
Sequence:CCGGCAAAGGATTATTTCCTGGGTTCTCGAGAACCCAGGAAATAATCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-363s1c1
Sequence:CCGGCAAGAAACACTCATTGAAGAACTCGAGTTCTTCAATGAGTGTTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167838    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-366s1c1
Sequence:CCGGGAAACACTCATTGAAGAAGATCTCGAGATCTTCTTCAATGAGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004323.1-626s1c1
Sequence:CCGGGCTGGAAGTCATCAGTGAGTTCTCGAGAACTCACTGATGACTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004323.1-405s21c1
Sequence:CCGGGGTTGAGACTTTGAGGTTGGTCTCGAGACCAACCTCAAAGTCTCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001004323.1-973s21c1
Sequence:CCGGTGGGAAATAAATATCAGATAGCTCGAGCTATCTGATATTTATTTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)