EMAIL THIS PAGE TO A FRIEND

C7orf62

chromosome 7 open reading frame 62

20 Gene Product Result for
Species: Human C7orf62(219557)
UniProtKB ID: Q8TBZ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002531 MISSION® esiRNA esiRNA targeting human C7orf62 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219108 predicted 737
2 SASI_Hs01_00219109 predicted 290
3 SASI_Hs02_00366601 predicted 292
4 SASI_Hs01_00219110 predicted 640
5 SASI_Hs01_00219111 predicted 296
6 SASI_Hs01_00219112 predicted 763
7 SASI_Hs01_00219113 predicted 744
8 SASI_Hs01_00219114 predicted 320
9 SASI_Hs01_00219115 predicted 376
10 SASI_Hs01_00219116 predicted 748
11 SASI_Hs01_00219117 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152706
C7orf62 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 62
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-533s21c1
Sequence:CCGGTGTCAAAGATGAAACAGTATTCTCGAGAATACTGTTTCATCTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-290s21c1
Sequence:CCGGGAAACAACGACTACACCTAAACTCGAGTTTAGGTGTAGTCGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-449s1c1
Sequence:CCGGGCTCATCTATCCCACTTCCATCTCGAGATGGAAGTGGGATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-681s1c1
Sequence:CCGGCTAAAGGAGGTCATCACAGATCTCGAGATCTGTGATGACCTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-261s1c1
Sequence:CCGGCGTAGCAATTACCTGCACTTTCTCGAGAAAGTGCAGGTAATTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-859s1c1
Sequence:CCGGCGGCAACATTTATAAACATGTCTCGAGACATGTTTATAAATGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152706
C7orf62 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 62
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-533s21c1
Sequence:CCGGTGTCAAAGATGAAACAGTATTCTCGAGAATACTGTTTCATCTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-290s21c1
Sequence:CCGGGAAACAACGACTACACCTAAACTCGAGTTTAGGTGTAGTCGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-449s1c1
Sequence:CCGGGCTCATCTATCCCACTTCCATCTCGAGATGGAAGTGGGATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-681s1c1
Sequence:CCGGCTAAAGGAGGTCATCACAGATCTCGAGATCTGTGATGACCTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-261s1c1
Sequence:CCGGCGTAGCAATTACCTGCACTTTCTCGAGAAAGTGCAGGTAATTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-859s1c1
Sequence:CCGGCGGCAACATTTATAAACATGTCTCGAGACATGTTTATAAATGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152706
C7orf62 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 62
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-533s21c1
Sequence:CCGGTGTCAAAGATGAAACAGTATTCTCGAGAATACTGTTTCATCTTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152706.2-290s21c1
Sequence:CCGGGAAACAACGACTACACCTAAACTCGAGTTTAGGTGTAGTCGTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-449s1c1
Sequence:CCGGGCTCATCTATCCCACTTCCATCTCGAGATGGAAGTGGGATAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-681s1c1
Sequence:CCGGCTAAAGGAGGTCATCACAGATCTCGAGATCTGTGATGACCTCCTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-261s1c1
Sequence:CCGGCGTAGCAATTACCTGCACTTTCTCGAGAAAGTGCAGGTAATTGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152706.2-859s1c1
Sequence:CCGGCGGCAACATTTATAAACATGTCTCGAGACATGTTTATAAATGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks