EMAIL THIS PAGE TO A FRIEND

C7orf63

chromosome 7 open reading frame 63

Species: Human C7orf63(79846)
Gene ID:
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039706 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039706 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039706 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082861 MISSION® esiRNA esiRNA human C7orf63 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039706 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039706 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138274 predicted 1141
2 SASI_Hs02_00308647 predicted 1817
3 SASI_Hs01_00138275 predicted 2549
4 SASI_Hs01_00138276 predicted 1461
5 SASI_Hs01_00138277 predicted 1474
6 SASI_Hs01_00138278 predicted 1036
7 SASI_Hs02_00308648 predicted 1116
8 SASI_Hs02_00308649 predicted 2650
9 SASI_Hs01_00138280 predicted 1353
10 SASI_Hs01_00138281 predicted 1699
11 SASI_Hs01_00138279 predicted 1273
12 SASI_Hs01_00138282 predicted 618
13 SASI_Hs01_00138283 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039706
C7orf63 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 63
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3278s21c1
Sequence:CCGGCTTTGGAAAGGCTACCAATTTCTCGAGAAATTGGTAGCCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1133s21c1
Sequence:CCGGCAGCTTAGAAATGACATATTACTCGAGTAATATGTCATTTCTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.2-378s21c1
Sequence:CCGGTTCAAGCCTATGGACCTTAATCTCGAGATTAAGGTCCATAGGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1879s21c1
Sequence:CCGGCGGAACTGAAGGAGTAGATATCTCGAGATATCTACTCCTTCAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-2557s21c1
Sequence:CCGGGCAAAGAGAGCTGGCTAATAACTCGAGTTATTAGCCAGCTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1356s21c1
Sequence:CCGGTACCTACTGTACAGCTATTAACTCGAGTTAATAGCTGTACAGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1938s21c1
Sequence:CCGGAGAGTGGCTTAGGCTATAATGCTCGAGCATTATAGCCTAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3343s21c1
Sequence:CCGGTTGGTTGCATGTGAACTATTCCTCGAGGAATAGTTCACATGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039706
C7orf63 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 63
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3278s21c1
Sequence:CCGGCTTTGGAAAGGCTACCAATTTCTCGAGAAATTGGTAGCCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1133s21c1
Sequence:CCGGCAGCTTAGAAATGACATATTACTCGAGTAATATGTCATTTCTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.2-378s21c1
Sequence:CCGGTTCAAGCCTATGGACCTTAATCTCGAGATTAAGGTCCATAGGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1879s21c1
Sequence:CCGGCGGAACTGAAGGAGTAGATATCTCGAGATATCTACTCCTTCAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-2557s21c1
Sequence:CCGGGCAAAGAGAGCTGGCTAATAACTCGAGTTATTAGCCAGCTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1356s21c1
Sequence:CCGGTACCTACTGTACAGCTATTAACTCGAGTTAATAGCTGTACAGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1938s21c1
Sequence:CCGGAGAGTGGCTTAGGCTATAATGCTCGAGCATTATAGCCTAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3343s21c1
Sequence:CCGGTTGGTTGCATGTGAACTATTCCTCGAGGAATAGTTCACATGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039706
C7orf63 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 63
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3278s21c1
Sequence:CCGGCTTTGGAAAGGCTACCAATTTCTCGAGAAATTGGTAGCCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1133s21c1
Sequence:CCGGCAGCTTAGAAATGACATATTACTCGAGTAATATGTCATTTCTAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.2-378s21c1
Sequence:CCGGTTCAAGCCTATGGACCTTAATCTCGAGATTAAGGTCCATAGGCTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1879s21c1
Sequence:CCGGCGGAACTGAAGGAGTAGATATCTCGAGATATCTACTCCTTCAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-2557s21c1
Sequence:CCGGGCAAAGAGAGCTGGCTAATAACTCGAGTTATTAGCCAGCTCTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1356s21c1
Sequence:CCGGTACCTACTGTACAGCTATTAACTCGAGTTAATAGCTGTACAGTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039706.1-1938s21c1
Sequence:CCGGAGAGTGGCTTAGGCTATAATGCTCGAGCATTATAGCCTAAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369570    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039706.2-3343s21c1
Sequence:CCGGTTGGTTGCATGTGAACTATTCCTCGAGGAATAGTTCACATGCAACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks