EMAIL THIS PAGE TO A FRIEND

C7orf65

chromosome 7 open reading frame 65

26 Gene Product Result for
Species: Human C7orf65(401335)
UniProtKB ID: Q6ZTY9, A4D2F8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001123065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001123065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001123065 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230691 MISSION® esiRNA esiRNA targeting human C7orf65 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001123065 Rosetta Predictions human pricing
XM_376607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327687 predicted 373
2 SASI_Hs02_00327688 predicted 887
3 SASI_Hs02_00327689 predicted 378
4 SASI_Hs02_00327690 predicted 556
5 SASI_Hs02_00327691 predicted 566
6 SASI_Hs02_00327692 predicted 844
7 SASI_Hs02_00327693 predicted 634
8 SASI_Hs02_00327694 predicted 857
9 SASI_Hs02_00327695 predicted 562
10 SASI_Hs02_00327696 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00270857 predicted 884
2 SASI_Hs01_00270858 predicted 819
3 SASI_Hs01_00270859 predicted 366
4 SASI_Hs01_00270860 predicted 312
5 SASI_Hs01_00270861 predicted 371
6 SASI_Hs01_00270862 predicted 572
7 SASI_Hs01_00270863 predicted 369
8 SASI_Hs01_00270864 predicted 248
9 SASI_Hs01_00270865 predicted 168
10 SASI_Hs01_00270866 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001123065
C7orf65 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 65
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-168s21c1
Sequence:CCGGAGAGCTGATGCTGAGTCTTTCCTCGAGGAAAGACTCAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-375s21c1
Sequence:CCGGTGCAAGGTGCTATACATAAATCTCGAGATTTATGTATAGCACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-303s21c1
Sequence:CCGGTCATGTGGAATCACCCTAGAGCTCGAGCTCTAGGGTGATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-421s21c1
Sequence:CCGGCTCAGGCCTGGATACTCATTGCTCGAGCAATGAGTATCCAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123065.1-714s21c1
Sequence:CCGGTGCTGGGTGAGGGTGATTATACTCGAGTATAATCACCCTCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001123065
C7orf65 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 65
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-168s21c1
Sequence:CCGGAGAGCTGATGCTGAGTCTTTCCTCGAGGAAAGACTCAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-375s21c1
Sequence:CCGGTGCAAGGTGCTATACATAAATCTCGAGATTTATGTATAGCACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-303s21c1
Sequence:CCGGTCATGTGGAATCACCCTAGAGCTCGAGCTCTAGGGTGATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-421s21c1
Sequence:CCGGCTCAGGCCTGGATACTCATTGCTCGAGCAATGAGTATCCAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123065.1-714s21c1
Sequence:CCGGTGCTGGGTGAGGGTGATTATACTCGAGTATAATCACCCTCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001123065
C7orf65 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 65
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-168s21c1
Sequence:CCGGAGAGCTGATGCTGAGTCTTTCCTCGAGGAAAGACTCAGCATCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-375s21c1
Sequence:CCGGTGCAAGGTGCTATACATAAATCTCGAGATTTATGTATAGCACCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-303s21c1
Sequence:CCGGTCATGTGGAATCACCCTAGAGCTCGAGCTCTAGGGTGATTCCACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001123065.1-421s21c1
Sequence:CCGGCTCAGGCCTGGATACTCATTGCTCGAGCAATGAGTATCCAGGCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001123065.1-714s21c1
Sequence:CCGGTGCTGGGTGAGGGTGATTATACTCGAGTATAATCACCCTCACCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks