EMAIL THIS PAGE TO A FRIEND

C7orf66

chromosome 7 open reading frame 66

17 Gene Product Result for
Species: Human C7orf66(154907)
UniProtKB ID: A4D0T2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001024607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001024607 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102171 MISSION® esiRNA esiRNA human AC004014.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164584 predicted 231
2 SASI_Hs01_00164586 predicted 111
3 SASI_Hs02_00307184 predicted 292
4 SASI_Hs01_00164588 predicted 181
5 SASI_Hs01_00164589 predicted 341
6 SASI_Hs01_00164590 predicted 318
7 SASI_Hs01_00164591 predicted 289
8 SASI_Hs01_00164592 predicted 250
9 SASI_Hs01_00164593 predicted 253
10 SASI_Hs02_00307185 predicted 292
11 SASI_Hs01_00164585 predicted 274
12 SASI_Hs01_00164587 predicted 86
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024607
C7orf66 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 66
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-253s1c1
Sequence:CCGGCAATATCGTCACATGATGGATCTCGAGATCCATCATGTGACGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-129s1c1
Sequence:CCGGCAGTTGCCTTGCAATGCTGTTCTCGAGAACAGCATTGCAAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-144s1c1
Sequence:CCGGGCTGTTTCAGGCTGTACTCATCTCGAGATGAGTACAGCCTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024607.1-139s1c1
Sequence:CCGGGCAATGCTGTTTCAGGCTGTACTCGAGTACAGCCTGAAACAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-151s1c1
Sequence:CCGGCAGGCTGTACTCATTCTTTCTCTCGAGAGAAAGAATGAGTACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-172s1c1
Sequence:CCGGGCACCACAAATGTCATGCCTTCTCGAGAAGGCATGACATTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024607
C7orf66 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 66
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-253s1c1
Sequence:CCGGCAATATCGTCACATGATGGATCTCGAGATCCATCATGTGACGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-129s1c1
Sequence:CCGGCAGTTGCCTTGCAATGCTGTTCTCGAGAACAGCATTGCAAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-144s1c1
Sequence:CCGGGCTGTTTCAGGCTGTACTCATCTCGAGATGAGTACAGCCTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024607.1-139s1c1
Sequence:CCGGGCAATGCTGTTTCAGGCTGTACTCGAGTACAGCCTGAAACAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-151s1c1
Sequence:CCGGCAGGCTGTACTCATTCTTTCTCTCGAGAGAAAGAATGAGTACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-172s1c1
Sequence:CCGGGCACCACAAATGTCATGCCTTCTCGAGAAGGCATGACATTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024607
C7orf66 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 66
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-253s1c1
Sequence:CCGGCAATATCGTCACATGATGGATCTCGAGATCCATCATGTGACGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-129s1c1
Sequence:CCGGCAGTTGCCTTGCAATGCTGTTCTCGAGAACAGCATTGCAAGGCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-144s1c1
Sequence:CCGGGCTGTTTCAGGCTGTACTCATCTCGAGATGAGTACAGCCTGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024607.1-139s1c1
Sequence:CCGGGCAATGCTGTTTCAGGCTGTACTCGAGTACAGCCTGAAACAGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-151s1c1
Sequence:CCGGCAGGCTGTACTCATTCTTTCTCTCGAGAGAAAGAATGAGTACAGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024607.1-172s1c1
Sequence:CCGGGCACCACAAATGTCATGCCTTCTCGAGAAGGCATGACATTTGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks