EMAIL THIS PAGE TO A FRIEND

C7orf69

chromosome 7 open reading frame 69

18 Gene Product Result for
Species: Human C7orf69(80099)
UniProtKB ID: Q9H7B7, A4D2F1, Q14CN7, Q75MJ5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025031 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159621 MISSION® esiRNA esiRNA human C7orf69 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025031 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357691 predicted 174
2 SASI_Hs01_00222961 predicted 600
3 SASI_Hs01_00222958 predicted 568
4 SASI_Hs02_00357692 predicted 204
5 SASI_Hs01_00222959 predicted 306
6 SASI_Hs01_00222960 predicted 301
7 SASI_Hs01_00222962 predicted 503
8 SASI_Hs02_00357693 predicted 340
9 SASI_Hs01_00222965 predicted 575
10 SASI_Hs01_00222966 predicted 306
11 SASI_Hs01_00222957 predicted 187
12 SASI_Hs01_00222963 predicted 486
13 SASI_Hs01_00222964 predicted 219
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025031
C7orf69 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 69
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-277s1c1
Sequence:CCGGCATCAGGAAAGGAGAACACAGCTCGAGCTGTGTTCTCCTTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-168s1c1
Sequence:CCGGGCTGGTTCTTAACTCTGAACTCTCGAGAGTTCAGAGTTAAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-288s1c1
Sequence:CCGGGAGAACACAGATGGAGACAGACTCGAGTCTGTCTCCATCTGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-89s1c1
Sequence:CCGGCACCATGTAAGAAGTGCCTTTCTCGAGAAAGGCACTTCTTACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-205s1c1
Sequence:CCGGCAAACTATCAAATGCAGAGCACTCGAGTGCTCTGCATTTGATAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-389s1c1
Sequence:CCGGGAAATAACTGCTGGTTTCACACTCGAGTGTGAAACCAGCAGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025031.1-494s1c1
Sequence:CCGGCTACAGAACACCCAGACTCATCTCGAGATGAGTCTGGGTGTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-137s1c1
Sequence:CCGGCCAAGTCATGTGGAAATGTCTCTCGAGAGACATTTCCACATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-276s1c1
Sequence:CCGGGCATCAGGAAAGGAGAACACACTCGAGTGTGTTCTCCTTTCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025031
C7orf69 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 69
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-277s1c1
Sequence:CCGGCATCAGGAAAGGAGAACACAGCTCGAGCTGTGTTCTCCTTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-168s1c1
Sequence:CCGGGCTGGTTCTTAACTCTGAACTCTCGAGAGTTCAGAGTTAAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-288s1c1
Sequence:CCGGGAGAACACAGATGGAGACAGACTCGAGTCTGTCTCCATCTGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-89s1c1
Sequence:CCGGCACCATGTAAGAAGTGCCTTTCTCGAGAAAGGCACTTCTTACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-205s1c1
Sequence:CCGGCAAACTATCAAATGCAGAGCACTCGAGTGCTCTGCATTTGATAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-389s1c1
Sequence:CCGGGAAATAACTGCTGGTTTCACACTCGAGTGTGAAACCAGCAGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025031.1-494s1c1
Sequence:CCGGCTACAGAACACCCAGACTCATCTCGAGATGAGTCTGGGTGTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-137s1c1
Sequence:CCGGCCAAGTCATGTGGAAATGTCTCTCGAGAGACATTTCCACATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-276s1c1
Sequence:CCGGGCATCAGGAAAGGAGAACACACTCGAGTGTGTTCTCCTTTCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025031
C7orf69 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 69
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-277s1c1
Sequence:CCGGCATCAGGAAAGGAGAACACAGCTCGAGCTGTGTTCTCCTTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-168s1c1
Sequence:CCGGGCTGGTTCTTAACTCTGAACTCTCGAGAGTTCAGAGTTAAGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137834    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-288s1c1
Sequence:CCGGGAGAACACAGATGGAGACAGACTCGAGTCTGTCTCCATCTGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136835    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025031.1-89s1c1
Sequence:CCGGCACCATGTAAGAAGTGCCTTTCTCGAGAAAGGCACTTCTTACATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-205s1c1
Sequence:CCGGCAAACTATCAAATGCAGAGCACTCGAGTGCTCTGCATTTGATAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-389s1c1
Sequence:CCGGGAAATAACTGCTGGTTTCACACTCGAGTGTGAAACCAGCAGTTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137600    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025031.1-494s1c1
Sequence:CCGGCTACAGAACACCCAGACTCATCTCGAGATGAGTCTGGGTGTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-137s1c1
Sequence:CCGGCCAAGTCATGTGGAAATGTCTCTCGAGAGACATTTCCACATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025031.1-276s1c1
Sequence:CCGGGCATCAGGAAAGGAGAACACACTCGAGTGTGTTCTCCTTTCCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks