EMAIL THIS PAGE TO A FRIEND

C7orf71

chromosome 7 open reading frame 71

62 Gene Product Result for
Species: Human C7orf71(285941)
UniProtKB ID: A4D174
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_380092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_380092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_380092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145531 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU218841 MISSION® esiRNA esiRNA targeting human C7orf71 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001722179 Rosetta Predictions human pricing
XM_379477 Rosetta Predictions human pricing
XM_380092 Rosetta Predictions human pricing
XM_933566 Rosetta Predictions human pricing
XM_938991 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001722179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00447633 predicted 1530
2 SASI_Hs02_00447634 predicted 1373
3 SASI_Hs02_00447635 predicted 1527
4 SASI_Hs02_00447636 predicted 1485
5 SASI_Hs02_00447637 predicted 1585
6 SASI_Hs02_00447638 predicted 1329
7 SASI_Hs02_00447639 predicted 1602
8 SASI_Hs02_00447640 predicted 1130
9 SASI_Hs02_00447641 predicted 1685
10 SASI_Hs02_00447642 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_379477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479833 predicted 1530
2 SASI_Hs02_00479834 predicted 1378
3 SASI_Hs02_00479835 predicted 1521
4 SASI_Hs02_00479836 predicted 1490
5 SASI_Hs02_00479837 predicted 1583
6 SASI_Hs02_00479838 predicted 1331
7 SASI_Hs02_00479839 predicted 1601
8 SASI_Hs01_00261470 predicted 1131
9 SASI_Hs02_00479840 predicted 1684
10 SASI_Hs02_00479841 predicted 1650
11 SASI_Hs01_00261463 predicted 1168
12 SASI_Hs01_00261464 predicted 1115
13 SASI_Hs01_00261465 predicted 1134
14 SASI_Hs01_00261466 predicted 1133
15 SASI_Hs01_00261467 predicted 1184
16 SASI_Hs01_00261468 predicted 1164
17 SASI_Hs01_00261469 predicted 1120
18 SASI_Hs01_00261471 predicted 1176
19 SASI_Hs01_00261472 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_380092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00479880 predicted 1533
2 SASI_Hs02_00479881 predicted 1373
3 SASI_Hs02_00479882 predicted 1529
4 SASI_Hs02_00479883 predicted 1489
5 SASI_Hs02_00479884 predicted 1589
6 SASI_Hs02_00479885 predicted 1324
7 SASI_Hs02_00479886 predicted 1607
8 SASI_Hs02_00479887 predicted 1131
9 SASI_Hs02_00479888 predicted 1692
10 SASI_Hs02_00479889 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274176 predicted 278
2 SASI_Hs01_00274177 predicted 256
3 SASI_Hs01_00274178 predicted 283
4 SASI_Hs01_00274179 predicted 278
5 SASI_Hs01_00274180 predicted 494
6 SASI_Hs01_00274181 predicted 260
7 SASI_Hs01_00274182 predicted 270
8 SASI_Hs01_00274183 predicted 280
9 SASI_Hs01_00274184 predicted 282
10 SASI_Hs01_00274185 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483407 predicted 1534
2 SASI_Hs02_00483408 predicted 1372
3 SASI_Hs02_00483409 predicted 1521
4 SASI_Hs02_00483410 predicted 1489
5 SASI_Hs02_00483411 predicted 1586
6 SASI_Hs02_00483412 predicted 1330
7 SASI_Hs02_00483413 predicted 1603
8 SASI_Hs02_00483414 predicted 1138
9 SASI_Hs02_00483415 predicted 1691
10 SASI_Hs02_00483416 predicted 1651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_380092
C7orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 71
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1083s1c1
Sequence:CCGGCTGTGGAGCTTCACAGTCTATCTCGAGATAGACTGTGAAGCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-1182s1c1
Sequence:CCGGGCAAACATGTTATCTGGCCCTCTCGAGAGGGCCAGATAACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-948s1c1
Sequence:CCGGGAGCTAGGATACAGTTCAATTCTCGAGAATTGAACTGTATCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-912s1c1
Sequence:CCGGGAACTCCAGAATCTGAGTGAACTCGAGTTCACTCAGATTCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1140s1c1
Sequence:CCGGGAGGAAATGGTTCCTTTCATTCTCGAGAATGAAAGGAACCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-810s1c1
Sequence:CCGGCACATGAGGACACAGAGACAACTCGAGTTGTCTCTGTGTCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-799s1c1
Sequence:CCGGCAGAGACAAGACACATGAGGACTCGAGTCCTCATGTGTCTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_380092
C7orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 71
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1083s1c1
Sequence:CCGGCTGTGGAGCTTCACAGTCTATCTCGAGATAGACTGTGAAGCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-1182s1c1
Sequence:CCGGGCAAACATGTTATCTGGCCCTCTCGAGAGGGCCAGATAACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-948s1c1
Sequence:CCGGGAGCTAGGATACAGTTCAATTCTCGAGAATTGAACTGTATCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-912s1c1
Sequence:CCGGGAACTCCAGAATCTGAGTGAACTCGAGTTCACTCAGATTCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1140s1c1
Sequence:CCGGGAGGAAATGGTTCCTTTCATTCTCGAGAATGAAAGGAACCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-810s1c1
Sequence:CCGGCACATGAGGACACAGAGACAACTCGAGTTGTCTCTGTGTCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-799s1c1
Sequence:CCGGCAGAGACAAGACACATGAGGACTCGAGTCCTCATGTGTCTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_380092
C7orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 71
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1083s1c1
Sequence:CCGGCTGTGGAGCTTCACAGTCTATCTCGAGATAGACTGTGAAGCTCCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-1182s1c1
Sequence:CCGGGCAAACATGTTATCTGGCCCTCTCGAGAGGGCCAGATAACATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-948s1c1
Sequence:CCGGGAGCTAGGATACAGTTCAATTCTCGAGAATTGAACTGTATCCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-912s1c1
Sequence:CCGGGAACTCCAGAATCTGAGTGAACTCGAGTTCACTCAGATTCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134275    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_380092.1-1140s1c1
Sequence:CCGGGAGGAAATGGTTCCTTTCATTCTCGAGAATGAAAGGAACCATTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-810s1c1
Sequence:CCGGCACATGAGGACACAGAGACAACTCGAGTTGTCTCTGTGTCCTCATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_380092.1-799s1c1
Sequence:CCGGCAGAGACAAGACACATGAGGACTCGAGTCCTCATGTGTCTTGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145531
C7orf71 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 71
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000442138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1035s21c1
Sequence:CCGGGACAATCCAGGGCCCATTAAACTCGAGTTTAATGGGCCCTGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1659s21c1
Sequence:CCGGACTTGCACTGAAGAATTTAATCTCGAGATTAAATTCTTCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1329s21c1
Sequence:CCGGTTATAGGGTTACCAGTTTAAACTCGAGTTTAAACTGGTAACCCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1119s21c1
Sequence:CCGGTTGAGGGTGGCATTATCAAATCTCGAGATTTGATAATGCCACCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145531
C7orf71 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 71
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000442138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1035s21c1
Sequence:CCGGGACAATCCAGGGCCCATTAAACTCGAGTTTAATGGGCCCTGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1659s21c1
Sequence:CCGGACTTGCACTGAAGAATTTAATCTCGAGATTAAATTCTTCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1329s21c1
Sequence:CCGGTTATAGGGTTACCAGTTTAAACTCGAGTTTAAACTGGTAACCCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1119s21c1
Sequence:CCGGTTGAGGGTGGCATTATCAAATCTCGAGATTTGATAATGCCACCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145531
C7orf71 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 71
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000442138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1035s21c1
Sequence:CCGGGACAATCCAGGGCCCATTAAACTCGAGTTTAATGGGCCCTGGATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1659s21c1
Sequence:CCGGACTTGCACTGAAGAATTTAATCTCGAGATTAAATTCTTCAGTGCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145531.1-1329s21c1
Sequence:CCGGTTATAGGGTTACCAGTTTAAACTCGAGTTTAAACTGGTAACCCTATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145531.1-1119s21c1
Sequence:CCGGTTGAGGGTGGCATTATCAAATCTCGAGATTTGATAATGCCACCCTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks