EMAIL THIS PAGE TO A FRIEND

C7orf72

chromosome 7 open reading frame 72

Species: Human C7orf72(100130988)
UniProtKB ID: A4D263, A6NDX9
Gene ID:
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301775 ANTI-TCAG7.1071 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001161834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001161834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001161834 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001713888 Rosetta Predictions human pricing
XM_001714376 Rosetta Predictions human pricing
XM_001714936 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00393590 predicted 470
2 SASI_Hs02_00393591 predicted 403
3 SASI_Hs02_00393592 predicted 391
4 SASI_Hs02_00393593 predicted 414
5 SASI_Hs02_00393594 predicted 538
6 SASI_Hs02_00393595 predicted 614
7 SASI_Hs02_00393596 predicted 492
8 SASI_Hs02_00393597 predicted 445
9 SASI_Hs02_00393598 predicted 478
10 SASI_Hs02_00393599 predicted 625
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00396688 predicted 812
2 SASI_Hs02_00396689 predicted 932
3 SASI_Hs02_00396690 predicted 465
4 SASI_Hs02_00396691 predicted 963
5 SASI_Hs02_00396692 predicted 405
6 SASI_Hs02_00396693 predicted 387
7 SASI_Hs02_00396694 predicted 610
8 SASI_Hs02_00396695 predicted 486
9 SASI_Hs02_00396696 predicted 441
10 SASI_Hs02_00396697 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001714936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00400379 predicted 593
2 SASI_Hs02_00400380 predicted 645
3 SASI_Hs02_00400381 predicted 594
4 SASI_Hs02_00400382 predicted 633
5 SASI_Hs02_00400383 predicted 454
6 SASI_Hs02_00400384 predicted 631
7 SASI_Hs02_00400385 predicted 580
8 SASI_Hs02_00400386 predicted 534
9 SASI_Hs02_00400387 predicted 597
10 SASI_Hs02_00400388 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001161834
C7orf72 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 72
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-913s21c1
Sequence:CCGGGCACCAGTCAAACCAATTAATCTCGAGATTAATTGGTTTGACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-1104s21c1
Sequence:CCGGATATACCGGCAAGGTTCATTTCTCGAGAAATGAACCTTGCCGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-592s21c1
Sequence:CCGGCATCATGAAGGACGCTCATTACTCGAGTAATGAGCGTCCTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161834.1-1573s21c1
Sequence:CCGGTCCTCTTTAGGGTTGGAATATCTCGAGATATTCCAACCCTAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-265s21c1
Sequence:CCGGGGGCCACATTATCCATTATTTCTCGAGAAATAATGGATAATGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001161834
C7orf72 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 72
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-913s21c1
Sequence:CCGGGCACCAGTCAAACCAATTAATCTCGAGATTAATTGGTTTGACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-1104s21c1
Sequence:CCGGATATACCGGCAAGGTTCATTTCTCGAGAAATGAACCTTGCCGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-592s21c1
Sequence:CCGGCATCATGAAGGACGCTCATTACTCGAGTAATGAGCGTCCTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161834.1-1573s21c1
Sequence:CCGGTCCTCTTTAGGGTTGGAATATCTCGAGATATTCCAACCCTAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-265s21c1
Sequence:CCGGGGGCCACATTATCCATTATTTCTCGAGAAATAATGGATAATGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001161834
C7orf72 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 72
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-913s21c1
Sequence:CCGGGCACCAGTCAAACCAATTAATCTCGAGATTAATTGGTTTGACTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-1104s21c1
Sequence:CCGGATATACCGGCAAGGTTCATTTCTCGAGAAATGAACCTTGCCGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-592s21c1
Sequence:CCGGCATCATGAAGGACGCTCATTACTCGAGTAATGAGCGTCCTTCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338979    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001161834.1-1573s21c1
Sequence:CCGGTCCTCTTTAGGGTTGGAATATCTCGAGATATTCCAACCCTAAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001161834.1-265s21c1
Sequence:CCGGGGGCCACATTATCCATTATTTCTCGAGAAATAATGGATAATGTGGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks