EMAIL THIS PAGE TO A FRIEND

C7orf73

chromosome 7 open reading frame 73

28 Gene Product Result for
Synonyms: PL-5283
Species: Human C7orf73(647087)
UniProtKB ID: E0CX11
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA065565 Anti-C7orf73 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130929 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130929 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130929 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_930101 Rosetta Predictions human pricing
XM_938850 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265854 predicted 729
2 SASI_Hs01_00265858 predicted 493
3 SASI_Hs01_00265859 predicted 950
4 SASI_Hs02_00481237 predicted 869
5 SASI_Hs01_00265860 predicted 489
6 SASI_Hs01_00265861 predicted 510
7 SASI_Hs01_00265863 predicted 707
8 SASI_Hs02_00481238 predicted 522
9 SASI_Hs02_00481239 predicted 867
10 SASI_Hs02_00481240 predicted 577
11 SASI_Hs01_00265855 predicted 956
12 SASI_Hs01_00265856 predicted 851
13 SASI_Hs01_00265857 predicted 722
14 SASI_Hs01_00265862 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_938850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483342 predicted 721
2 SASI_Hs02_00483343 predicted 500
3 SASI_Hs02_00483344 predicted 953
4 SASI_Hs02_00483345 predicted 873
5 SASI_Hs02_00483346 predicted 488
6 SASI_Hs02_00483347 predicted 512
7 SASI_Hs02_00483348 predicted 706
8 SASI_Hs02_00483349 predicted 523
9 SASI_Hs02_00483350 predicted 864
10 SASI_Hs02_00483351 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130929
VALIDATED
C7orf73 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 73
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-113s21c1
Sequence:CCGGCCAGTTCCTGCTTGGATTTACCTCGAGGTAAATCCAAGCAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-136s21c1
Sequence:CCGGTGGGCAACGTGGTTGGAATGTCTCGAGACATTCCAACCACGTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-214s21c1
Sequence:CCGGAGGACTTGGATGCCAAGAAGACTCGAGTCTTCTTGGCATCCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-158s21c1
Sequence:CCGGTCTGGCTCAGAACTATGATATCTCGAGATATCATAGTTCTGAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-499s21c1
Sequence:CCGGTTATGGTGCTAGATTAGTAAACTCGAGTTTACTAATCTAGCACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130929
VALIDATED
C7orf73 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 73
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-113s21c1
Sequence:CCGGCCAGTTCCTGCTTGGATTTACCTCGAGGTAAATCCAAGCAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-136s21c1
Sequence:CCGGTGGGCAACGTGGTTGGAATGTCTCGAGACATTCCAACCACGTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-214s21c1
Sequence:CCGGAGGACTTGGATGCCAAGAAGACTCGAGTCTTCTTGGCATCCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-158s21c1
Sequence:CCGGTCTGGCTCAGAACTATGATATCTCGAGATATCATAGTTCTGAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-499s21c1
Sequence:CCGGTTATGGTGCTAGATTAGTAAACTCGAGTTTACTAATCTAGCACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130929
VALIDATED
C7orf73 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 73
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-113s21c1
Sequence:CCGGCCAGTTCCTGCTTGGATTTACCTCGAGGTAAATCCAAGCAGGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-136s21c1
Sequence:CCGGTGGGCAACGTGGTTGGAATGTCTCGAGACATTCCAACCACGTTGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-214s21c1
Sequence:CCGGAGGACTTGGATGCCAAGAAGACTCGAGTCTTCTTGGCATCCAAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-158s21c1
Sequence:CCGGTCTGGCTCAGAACTATGATATCTCGAGATATCATAGTTCTGAGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256822    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001130929.1-499s21c1
Sequence:CCGGTTATGGTGCTAGATTAGTAAACTCGAGTTTACTAATCTAGCACCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks