EMAIL THIS PAGE TO A FRIEND

C7orf76

chromosome 7 open reading frame 76

50 Gene Product Result for
Species: Human C7orf76(401388)
UniProtKB ID: Q6ZVN7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207503 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207503 Rosetta Predictions human pricing
XR_040255 Rosetta Predictions human pricing
XR_040256 Rosetta Predictions human pricing
XR_040257 Rosetta Predictions human pricing
XR_040258 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205281 predicted 214
2 SASI_Hs01_00205282 predicted 273
3 SASI_Hs01_00205283 predicted 252
4 SASI_Hs01_00205284 predicted 209
5 SASI_Hs01_00205285 predicted 510
6 SASI_Hs01_00205286 predicted 238
7 SASI_Hs01_00205287 predicted 502
8 SASI_Hs01_00205288 predicted 467
9 SASI_Hs01_00205289 predicted 142
10 SASI_Hs01_00205290 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517246 predicted 305
2 SASI_Hs02_00517247 predicted 1525
3 SASI_Hs02_00517248 predicted 1489
4 SASI_Hs02_00517249 predicted 1419
5 SASI_Hs02_00517250 predicted 1382
6 SASI_Hs02_00517251 predicted 1511
7 SASI_Hs02_00517252 predicted 268
8 SASI_Hs02_00517253 predicted 1399
9 SASI_Hs02_00517254 predicted 243
10 SASI_Hs02_00517255 predicted 1467
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517256 predicted 297
2 SASI_Hs02_00517257 predicted 1533
3 SASI_Hs02_00517258 predicted 1485
4 SASI_Hs02_00517259 predicted 1420
5 SASI_Hs02_00517260 predicted 1381
6 SASI_Hs02_00517261 predicted 1513
7 SASI_Hs02_00517262 predicted 274
8 SASI_Hs02_00517263 predicted 1399
9 SASI_Hs02_00517264 predicted 246
10 SASI_Hs02_00517265 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040257 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517266 predicted 306
2 SASI_Hs02_00517267 predicted 1530
3 SASI_Hs02_00517268 predicted 1489
4 SASI_Hs02_00517269 predicted 1414
5 SASI_Hs02_00517270 predicted 1382
6 SASI_Hs02_00517271 predicted 1512
7 SASI_Hs02_00517272 predicted 273
8 SASI_Hs02_00517273 predicted 1399
9 SASI_Hs02_00517274 predicted 243
10 SASI_Hs02_00517275 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517276 predicted 304
2 SASI_Hs02_00517277 predicted 1526
3 SASI_Hs02_00517278 predicted 1485
4 SASI_Hs02_00517279 predicted 1414
5 SASI_Hs02_00517280 predicted 1386
6 SASI_Hs02_00517281 predicted 1518
7 SASI_Hs02_00517282 predicted 270
8 SASI_Hs02_00517283 predicted 1399
9 SASI_Hs02_00517284 predicted 246
10 SASI_Hs02_00517285 predicted 1470
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207503
C7orf76 MISSION shRNA Bacterial Glycerol Stock
chromosome 7 open reading frame 76
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000167752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-252s1c1
Sequence:CCGGGCAACAGATAAACTTGGAGATCTCGAGATCTCCAAGTTTATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-115s1c1
Sequence:CCGGGCTGTGTTTGCTGTACAAGGACTCGAGTCCTTGTACAGCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-386s1c1
Sequence:CCGGCCTTGGTGCACTGTGAAGATTCTCGAGAATCTTCACAGTGCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207503
C7orf76 MISSION shRNA shRNA Plasmid DNA
chromosome 7 open reading frame 76
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000167752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-252s1c1
Sequence:CCGGGCAACAGATAAACTTGGAGATCTCGAGATCTCCAAGTTTATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-115s1c1
Sequence:CCGGGCTGTGTTTGCTGTACAAGGACTCGAGTCCTTGTACAGCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-386s1c1
Sequence:CCGGCCTTGGTGCACTGTGAAGATTCTCGAGAATCTTCACAGTGCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207503
C7orf76 MISSION shRNA Lentiviral Transduction Particles
chromosome 7 open reading frame 76
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000167752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-252s1c1
Sequence:CCGGGCAACAGATAAACTTGGAGATCTCGAGATCTCCAAGTTTATCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-115s1c1
Sequence:CCGGGCTGTGTTTGCTGTACAAGGACTCGAGTCCTTGTACAGCAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207503.1-386s1c1
Sequence:CCGGCCTTGGTGCACTGTGAAGATTCTCGAGAATCTTCACAGTGCACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks