EMAIL THIS PAGE TO A FRIEND

C8A

complement component 8, alpha polypeptide

50 Gene Product Result for
UniProtKB ID: P07357, A2RUI4, A2RUI5, Q13668, Q9H130
Gene ID:
Human(731) Summary: C8 is a component of the complement system and contains three polypeptides, alpha, beta and gamma. This gene encodes the alpha subunit of C8. C8 participates in the formation of the membrane attack complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause complement C8 alpha-gamma deficiency. [provided by RefSeq, Nov 2008]
Mouse(230558) complement component 8, alpha polypeptide
Rat(298288) complement component 8, alpha polypeptide
naked mole-rat(101697109) complement component 8, alpha polypeptide
domestic guinea pig(100729882) complement component 8, alpha polypeptide
sheep(101102273) complement component 8, alpha polypeptide
Domestic Rabbit(100009076) complement component 8, alpha polypeptide
Zebrafish(445102) complement component 8, alpha polypeptide
dog(479556) complement component 8, alpha polypeptide
Horse(100059461) complement component 8, alpha polypeptide
cow(527391) complement component 8, alpha polypeptide
domestic cat(101096500) complement component 8, alpha polypeptide
chicken(429111) complement component 8, alpha polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104759 Anti-C8A (56-70) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000562 Rosetta Predictions human pricing
NM_001106670 Rosetta Predictions rat pricing
NM_146148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113004 predicted 1120
2 SASI_Hs01_00113005 predicted 1066
3 SASI_Hs01_00113006 predicted 753
4 SASI_Hs02_00302806 predicted 782
5 SASI_Hs01_00113007 predicted 1592
6 SASI_Hs01_00113010 predicted 273
7 SASI_Hs01_00113011 predicted 1235
8 SASI_Hs01_00113012 predicted 241
9 SASI_Hs01_00113013 predicted 867
10 SASI_Hs02_00302807 predicted 682
11 SASI_Hs01_00113008 predicted 836
12 SASI_Hs01_00113009 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221228 predicted 559
2 SASI_Rn02_00221229 predicted 760
3 SASI_Rn02_00221230 predicted 685
4 SASI_Rn02_00221231 predicted 1302
5 SASI_Rn02_00221232 predicted 869
6 SASI_Rn02_00221233 predicted 535
7 SASI_Rn02_00221234 predicted 235
8 SASI_Rn02_00221235 predicted 819
9 SASI_Rn02_00221236 predicted 439
10 SASI_Rn02_00221237 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097632 predicted 1021
2 SASI_Mm01_00097633 predicted 1013
3 SASI_Mm01_00097634 predicted 1509
4 SASI_Mm01_00097635 predicted 1727
5 SASI_Mm01_00097637 predicted 407
6 SASI_Mm01_00097638 predicted 1180
7 SASI_Mm01_00097639 predicted 236
8 SASI_Mm02_00341834 predicted 1205
9 SASI_Mm01_00097640 predicted 327
10 SASI_Mm01_00097641 predicted 1073
11 SASI_Mm01_00097636 predicted 970
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000562
C8A MISSION shRNA Bacterial Glycerol Stock
complement component 8, alpha polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1165s21c1
Sequence:CCGGGGATCCATGGGTGGCATTTATCTCGAGATAAATGCCACCCATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1488s21c1
Sequence:CCGGTAATCCTGTTGTTATCGATTTCTCGAGAAATCGATAACAACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-631s21c1
Sequence:CCGGGTGTACGATGCCAGTTATTATCTCGAGATAATAACTGGCATCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-940s1c1
Sequence:CCGGCCCACTCACAAGACACTTCATCTCGAGATGAAGTGTCTTGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1199s1c1
Sequence:CCGGCCTGGTGATTGACAAAGCAAACTCGAGTTTGCTTTGTCAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-391s1c1
Sequence:CCGGCCAGTTCTACAACTTGTGTAACTCGAGTTACACAAGTTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1107s1c1
Sequence:CCGGCAGTACAATTATGGCATGTATCTCGAGATACATGCCATAATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1312s1c1
Sequence:CCGGGAGGTTTATCAGGAGACCATTCTCGAGAATGGTCTCCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000562
C8A MISSION shRNA shRNA Plasmid DNA
complement component 8, alpha polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1165s21c1
Sequence:CCGGGGATCCATGGGTGGCATTTATCTCGAGATAAATGCCACCCATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1488s21c1
Sequence:CCGGTAATCCTGTTGTTATCGATTTCTCGAGAAATCGATAACAACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-631s21c1
Sequence:CCGGGTGTACGATGCCAGTTATTATCTCGAGATAATAACTGGCATCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-940s1c1
Sequence:CCGGCCCACTCACAAGACACTTCATCTCGAGATGAAGTGTCTTGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1199s1c1
Sequence:CCGGCCTGGTGATTGACAAAGCAAACTCGAGTTTGCTTTGTCAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-391s1c1
Sequence:CCGGCCAGTTCTACAACTTGTGTAACTCGAGTTACACAAGTTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1107s1c1
Sequence:CCGGCAGTACAATTATGGCATGTATCTCGAGATACATGCCATAATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1312s1c1
Sequence:CCGGGAGGTTTATCAGGAGACCATTCTCGAGAATGGTCTCCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000562
C8A MISSION shRNA Lentiviral Transduction Particles
complement component 8, alpha polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1165s21c1
Sequence:CCGGGGATCCATGGGTGGCATTTATCTCGAGATAAATGCCACCCATGGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-1488s21c1
Sequence:CCGGTAATCCTGTTGTTATCGATTTCTCGAGAAATCGATAACAACAGGATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000562.2-631s21c1
Sequence:CCGGGTGTACGATGCCAGTTATTATCTCGAGATAATAACTGGCATCGTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-940s1c1
Sequence:CCGGCCCACTCACAAGACACTTCATCTCGAGATGAAGTGTCTTGTGAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1199s1c1
Sequence:CCGGCCTGGTGATTGACAAAGCAAACTCGAGTTTGCTTTGTCAATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-391s1c1
Sequence:CCGGCCAGTTCTACAACTTGTGTAACTCGAGTTACACAAGTTGTAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1107s1c1
Sequence:CCGGCAGTACAATTATGGCATGTATCTCGAGATACATGCCATAATTGTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000562.1-1312s1c1
Sequence:CCGGGAGGTTTATCAGGAGACCATTCTCGAGAATGGTCTCCTGATAAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146148
C8A MISSION shRNA Bacterial Glycerol Stock
complement component 8, alpha polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1029s1c1
Sequence:CCGGGCCAAGTTCATCAATGACTATCTCGAGATAGTCATTGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-842s1c1
Sequence:CCGGCGGGTCCAAAGCATCTTCATTCTCGAGAATGAAGATGCTTTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-374s1c1
Sequence:CCGGCCTGGTGTGTAACGGAGATAACTCGAGTTATCTCCGTTACACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1180s1c1
Sequence:CCGGGCATAGGAATTAAGGATAGTACTCGAGTACTATCCTTAATTCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-662s1c1
Sequence:CCGGGCCCTACAACTTCCTTAAGTACTCGAGTACTTAAGGAAGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146148
C8A MISSION shRNA shRNA Plasmid DNA
complement component 8, alpha polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1029s1c1
Sequence:CCGGGCCAAGTTCATCAATGACTATCTCGAGATAGTCATTGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-842s1c1
Sequence:CCGGCGGGTCCAAAGCATCTTCATTCTCGAGAATGAAGATGCTTTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-374s1c1
Sequence:CCGGCCTGGTGTGTAACGGAGATAACTCGAGTTATCTCCGTTACACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1180s1c1
Sequence:CCGGGCATAGGAATTAAGGATAGTACTCGAGTACTATCCTTAATTCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-662s1c1
Sequence:CCGGGCCCTACAACTTCCTTAAGTACTCGAGTACTTAAGGAAGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146148
C8A MISSION shRNA Lentiviral Transduction Particles
complement component 8, alpha polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1029s1c1
Sequence:CCGGGCCAAGTTCATCAATGACTATCTCGAGATAGTCATTGATGAACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-842s1c1
Sequence:CCGGCGGGTCCAAAGCATCTTCATTCTCGAGAATGAAGATGCTTTGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-374s1c1
Sequence:CCGGCCTGGTGTGTAACGGAGATAACTCGAGTTATCTCCGTTACACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-1180s1c1
Sequence:CCGGGCATAGGAATTAAGGATAGTACTCGAGTACTATCCTTAATTCCTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146148.1-662s1c1
Sequence:CCGGGCCCTACAACTTCCTTAAGTACTCGAGTACTTAAGGAAGTTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks