EMAIL THIS PAGE TO A FRIEND

C8B

complement component 8, beta polypeptide

56 Gene Product Result for
Synonyms: C82
UniProtKB ID: P07358, A1L4K7
Gene ID:
Human(732) Summary: This gene encodes one of the three subunits of the complement component 8 (C8) protein. C8 is composed of equimolar amounts of alpha, beta and gamma subunits, which are encoded by three separate genes. C8 is one component of the membrane attack complex, which mediates cell lysis, and it initiates membrane penetration of the complex. This protein mediates the interaction of C8 with the C5b-7 membrane attack complex precursor. In humans deficiency of this protein is associated with increased risk of meningococcal infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Mouse(110382) complement component 8, beta polypeptide
Rat(313421) complement component 8, beta polypeptide
Zebrafish(793127) complement component 8, beta polypeptide
chicken(424669) complement component 8, beta polypeptide
cow(513217) complement component 8, beta polypeptide
Horse(100059423) complement component 8, beta polypeptide
domestic cat(101099229) complement component 8, beta polypeptide
dog(479555) complement component 8, beta polypeptide
sheep(101102522) complement component 8, beta polypeptide
Domestic Rabbit(100009385) complement component 8, beta polypeptide
domestic guinea pig(100729610) complement component 8, beta polypeptide
naked mole-rat(101696501) complement component 8, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV44210 Anti-C8B (AB1) antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, rat, bovine, canine, pig
immunohistochemistry, western blot pricing
AV44211 Anti-C8B (AB2) antibody produced in rabbit affinity isolated antibody canine, rat, rabbit, human, pig, mouse
western blot pricing
HPA023694 Anti-C8B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000066 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000066 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000066 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001791 MISSION® esiRNA esiRNA targeting human C8B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000066 Rosetta Predictions human pricing
XM_001058539 Rosetta Predictions rat pricing
XM_233250 Rosetta Predictions rat pricing
NM_133882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000066 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058179 predicted 1752
2 SASI_Hs01_00058180 predicted 1802
3 SASI_Hs01_00058181 predicted 687
4 SASI_Hs01_00058182 predicted 459
5 SASI_Hs01_00058183 predicted 1559
6 SASI_Hs01_00058184 predicted 520
7 SASI_Hs02_00301787 predicted 882
8 SASI_Hs01_00058185 predicted 631
9 SASI_Hs01_00058186 predicted 1360
10 SASI_Hs01_00058187 predicted 1479
11 SASI_Hs01_00058188 predicted 891
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290079 predicted 820
2 SASI_Rn02_00290080 predicted 1246
3 SASI_Rn02_00290081 predicted 678
4 SASI_Rn02_00290082 predicted 741
5 SASI_Rn02_00290083 predicted 521
6 SASI_Rn02_00290084 predicted 1009
7 SASI_Rn02_00290085 predicted 1805
8 SASI_Rn02_00290086 predicted 495
9 SASI_Rn02_00290087 predicted 452
10 SASI_Rn02_00290088 predicted 1169
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00387552 predicted 812
2 SASI_Rn02_00387553 predicted 1249
3 SASI_Rn02_00387554 predicted 684
4 SASI_Rn02_00387555 predicted 742
5 SASI_Rn02_00387556 predicted 525
6 SASI_Rn02_00387557 predicted 1010
7 SASI_Rn02_00387558 predicted 1798
8 SASI_Rn02_00387559 predicted 495
9 SASI_Rn02_00387560 predicted 455
10 SASI_Rn02_00387561 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338937 predicted 1241
2 SASI_Mm01_00077151 predicted 855
3 SASI_Mm01_00077152 predicted 1525
4 SASI_Mm01_00077153 predicted 976
5 SASI_Mm01_00077154 predicted 1375
6 SASI_Mm01_00077155 predicted 194
7 SASI_Mm01_00077157 predicted 1330
8 SASI_Mm01_00077158 predicted 1441
9 SASI_Mm02_00338938 predicted 1070
10 SASI_Mm01_00077159 predicted 1176
11 SASI_Mm01_00077156 predicted 610
12 SASI_Mm01_00077160 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000066
C8B MISSION shRNA Bacterial Glycerol Stock
complement component 8, beta polypeptide
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1697s1c1
Sequence:CCGGGCTCTGGAAGACGTAAGACAACTCGAGTTGTCTTACGTCTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-872s1c1
Sequence:CCGGCCAAACGATTCTCTCATACTACTCGAGTAGTATGAGAGAATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-212s1c1
Sequence:CCGGCCATTGATTGTGAGCTGTCTACTCGAGTAGACAGCTCACAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-748s1c1
Sequence:CCGGGAACGCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1236s1c1
Sequence:CCGGCAGAGGTATTCTGAATGAAATCTCGAGATTTCATTCAGAATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-635s21c1
Sequence:CCGGGTTCTTGATCACAGGTATTATCTCGAGATAATACCTGTGATCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-884s21c1
Sequence:CCGGGATCGAGGCAAACACTATATTCTCGAGAATATAGTGTTTGCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000066
C8B MISSION shRNA shRNA Plasmid DNA
complement component 8, beta polypeptide
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1697s1c1
Sequence:CCGGGCTCTGGAAGACGTAAGACAACTCGAGTTGTCTTACGTCTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-872s1c1
Sequence:CCGGCCAAACGATTCTCTCATACTACTCGAGTAGTATGAGAGAATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-212s1c1
Sequence:CCGGCCATTGATTGTGAGCTGTCTACTCGAGTAGACAGCTCACAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-748s1c1
Sequence:CCGGGAACGCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1236s1c1
Sequence:CCGGCAGAGGTATTCTGAATGAAATCTCGAGATTTCATTCAGAATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-635s21c1
Sequence:CCGGGTTCTTGATCACAGGTATTATCTCGAGATAATACCTGTGATCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-884s21c1
Sequence:CCGGGATCGAGGCAAACACTATATTCTCGAGAATATAGTGTTTGCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000066
C8B MISSION shRNA Lentiviral Transduction Particles
complement component 8, beta polypeptide
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1697s1c1
Sequence:CCGGGCTCTGGAAGACGTAAGACAACTCGAGTTGTCTTACGTCTTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-872s1c1
Sequence:CCGGCCAAACGATTCTCTCATACTACTCGAGTAGTATGAGAGAATCGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-212s1c1
Sequence:CCGGCCATTGATTGTGAGCTGTCTACTCGAGTAGACAGCTCACAATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-748s1c1
Sequence:CCGGGAACGCAATGTCACAGAGAAACTCGAGTTTCTCTGTGACATTGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000066.1-1236s1c1
Sequence:CCGGCAGAGGTATTCTGAATGAAATCTCGAGATTTCATTCAGAATACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-635s21c1
Sequence:CCGGGTTCTTGATCACAGGTATTATCTCGAGATAATACCTGTGATCAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000066.2-884s21c1
Sequence:CCGGGATCGAGGCAAACACTATATTCTCGAGAATATAGTGTTTGCCTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133882
C8B MISSION shRNA Bacterial Glycerol Stock
complement component 8, beta polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-181s1c1
Sequence:CCGGGCCCGATTTCTTTGAGACAAACTCGAGTTTGTCTCAAAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1456s1c1
Sequence:CCGGCCCAGCAATCATTAAGATCAACTCGAGTTGATCTTAATGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-260s1c1
Sequence:CCGGGCACCTATTGACTGTGAGCTACTCGAGTAGCTCACAGTCAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1287s1c1
Sequence:CCGGGCAGTGACATTATGAAAGAAACTCGAGTTTCTTTCATAATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-864s1c1
Sequence:CCGGGCGTTATGGATCTTGGAATTACTCGAGTAATTCCAAGATCCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133882
C8B MISSION shRNA shRNA Plasmid DNA
complement component 8, beta polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-181s1c1
Sequence:CCGGGCCCGATTTCTTTGAGACAAACTCGAGTTTGTCTCAAAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1456s1c1
Sequence:CCGGCCCAGCAATCATTAAGATCAACTCGAGTTGATCTTAATGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-260s1c1
Sequence:CCGGGCACCTATTGACTGTGAGCTACTCGAGTAGCTCACAGTCAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1287s1c1
Sequence:CCGGGCAGTGACATTATGAAAGAAACTCGAGTTTCTTTCATAATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-864s1c1
Sequence:CCGGGCGTTATGGATCTTGGAATTACTCGAGTAATTCCAAGATCCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133882
C8B MISSION shRNA Lentiviral Transduction Particles
complement component 8, beta polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-181s1c1
Sequence:CCGGGCCCGATTTCTTTGAGACAAACTCGAGTTTGTCTCAAAGAAATCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1456s1c1
Sequence:CCGGCCCAGCAATCATTAAGATCAACTCGAGTTGATCTTAATGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-260s1c1
Sequence:CCGGGCACCTATTGACTGTGAGCTACTCGAGTAGCTCACAGTCAATAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-1287s1c1
Sequence:CCGGGCAGTGACATTATGAAAGAAACTCGAGTTTCTTTCATAATGTCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133882.1-864s1c1
Sequence:CCGGGCGTTATGGATCTTGGAATTACTCGAGTAATTCCAAGATCCATAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks