EMAIL THIS PAGE TO A FRIEND

C8G

complement component 8, gamma polypeptide

Synonyms: C8C
UniProtKB ID: P07360, Q14CT8, Q14CU0, Q5SQ07
Gene ID:
Human(733) Summary: The protein encoded by this gene belongs to the lipocalin family. It is one of the three subunits that constitutes complement component 8 (C8), which is composed of a disulfide-linked C8 alpha-gamma heterodimer and a non-covalently associated C8 beta chain. C8 participates in the formation of the membrane attack complex (MAC) on bacterial cell membranes. While subunits alpha and beta play a role in complement-mediated bacterial killing, the gamma subunit is not required for the bactericidal activity. [provided by RefSeq, Jul 2011]
Mouse(69379) complement component 8, gamma polypeptide
Rat(296545) complement component 8, gamma polypeptide
naked mole-rat(101703244) complement component 8, gamma polypeptide
domestic guinea pig(100718503) complement component 8, gamma polypeptide
Domestic Rabbit(100009075) complement component 8, gamma polypeptide
Zebrafish(393837) complement component 8, gamma polypeptide
cow(517356) complement component 8, gamma polypeptide
domestic cat(101098834) complement component 8, gamma polypeptide
chicken(770691) complement component 8, gamma polypeptide
dog(480672) complement component 8, gamma polypeptide
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301703 Anti-C8G affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA046269 Anti-C8G antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027062 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027062 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027062 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_130127 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130127 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130127 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU008261 MISSION® esiRNA esiRNA targeting human C8G (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000606 Rosetta Predictions human pricing
NM_001106555 Rosetta Predictions rat pricing
XM_215990 Rosetta Predictions rat pricing
NM_027062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302894 predicted 470
2 SASI_Hs02_00302895 predicted 327
3 SASI_Hs02_00302896 predicted 471
4 SASI_Hs01_00050880 predicted 585
5 SASI_Hs02_00302897 predicted 646
6 SASI_Hs02_00302898 predicted 326
7 SASI_Hs01_00050883 predicted 470
8 SASI_Hs01_00050887 predicted 327
9 SASI_Hs02_00302899 predicted 623
10 SASI_Hs02_00302900 predicted 338
11 SASI_Hs01_00050881 predicted 537
12 SASI_Hs01_00050882 predicted 275
13 SASI_Hs01_00050884 predicted 353
14 SASI_Hs01_00050885 predicted 519
15 SASI_Hs01_00050886 predicted 522
16 SASI_Hs01_00050888 predicted 578
17 SASI_Hs01_00050889 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106555 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220108 predicted 267
2 SASI_Rn02_00220109 predicted 568
3 SASI_Rn02_00220110 predicted 592
4 SASI_Rn02_00220111 predicted 447
5 SASI_Rn02_00220112 predicted 206
6 SASI_Rn02_00220113 predicted 517
7 SASI_Rn02_00220114 predicted 450
8 SASI_Rn02_00220115 predicted 427
9 SASI_Rn02_00220116 predicted 292
10 SASI_Rn02_00220117 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215990 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149249 predicted 908
2 SASI_Rn01_00149250 predicted 968
3 SASI_Rn01_00149251 predicted 909
4 SASI_Rn01_00149252 predicted 875
5 SASI_Rn01_00149253 predicted 854
6 SASI_Rn01_00149254 predicted 914
7 SASI_Rn01_00149255 predicted 827
8 SASI_Rn01_00149256 predicted 842
9 SASI_Rn01_00149257 predicted 906
10 SASI_Rn01_00149258 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121520 predicted 439
2 SASI_Mm02_00331483 predicted 558
3 SASI_Mm01_00121521 predicted 795
4 SASI_Mm01_00121522 predicted 537
5 SASI_Mm01_00121523 predicted 526
6 SASI_Mm01_00121524 predicted 374
7 SASI_Mm01_00121525 predicted 657
8 SASI_Mm01_00121526 predicted 476
9 SASI_Mm01_00121527 predicted 790
10 SASI_Mm01_00121528 predicted 400
11 SASI_Mm01_00121529 predicted 667
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000606
C8G MISSION shRNA Bacterial Glycerol Stock
complement component 8, gamma polypeptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-180s21c1
Sequence:CCGGCATCCAGCCCAAGGCCAATTTCTCGAGAAATTGGCCTTGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-509s21c1
Sequence:CCGGAGCTGTCAGTGAAGCTCTACGCTCGAGCGTAGAGCTTCACTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-595s21c1
Sequence:CCGGCTGACTGAGGACCAGATCTTCCTCGAGGAAGATCTGGTCCTCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000606.2-692s21c1
Sequence:CCGGACACAGCTCCAGTGCTGAGAACTCGAGTTCTCAGCACTGGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c2
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c2
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-445s1c1
Sequence:CCGGTGAGACCGACTACCAGAGTTTCTCGAGAAACTCTGGTAGTCGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-536s1c1
Sequence:CCGGGACTCGGTCCTGAGTGGGTTTCTCGAGAAACCCACTCAGGACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-638s1c1
Sequence:CCGGCAGTTCCACGTCCTGGACGAACTCGAGTTCGTCCAGGACGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c1
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c1
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000606
C8G MISSION shRNA shRNA Plasmid DNA
complement component 8, gamma polypeptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-180s21c1
Sequence:CCGGCATCCAGCCCAAGGCCAATTTCTCGAGAAATTGGCCTTGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-509s21c1
Sequence:CCGGAGCTGTCAGTGAAGCTCTACGCTCGAGCGTAGAGCTTCACTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-595s21c1
Sequence:CCGGCTGACTGAGGACCAGATCTTCCTCGAGGAAGATCTGGTCCTCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000606.2-692s21c1
Sequence:CCGGACACAGCTCCAGTGCTGAGAACTCGAGTTCTCAGCACTGGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c2
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c2
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-445s1c1
Sequence:CCGGTGAGACCGACTACCAGAGTTTCTCGAGAAACTCTGGTAGTCGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-536s1c1
Sequence:CCGGGACTCGGTCCTGAGTGGGTTTCTCGAGAAACCCACTCAGGACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-638s1c1
Sequence:CCGGCAGTTCCACGTCCTGGACGAACTCGAGTTCGTCCAGGACGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c1
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c1
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000606
C8G MISSION shRNA Lentiviral Transduction Particles
complement component 8, gamma polypeptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-180s21c1
Sequence:CCGGCATCCAGCCCAAGGCCAATTTCTCGAGAAATTGGCCTTGGGCTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-509s21c1
Sequence:CCGGAGCTGTCAGTGAAGCTCTACGCTCGAGCGTAGAGCTTCACTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000606.2-595s21c1
Sequence:CCGGCTGACTGAGGACCAGATCTTCCTCGAGGAAGATCTGGTCCTCAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371559    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000606.2-692s21c1
Sequence:CCGGACACAGCTCCAGTGCTGAGAACTCGAGTTCTCAGCACTGGAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c2
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c2
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-445s1c1
Sequence:CCGGTGAGACCGACTACCAGAGTTTCTCGAGAAACTCTGGTAGTCGGTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-536s1c1
Sequence:CCGGGACTCGGTCCTGAGTGGGTTTCTCGAGAAACCCACTCAGGACCGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-638s1c1
Sequence:CCGGCAGTTCCACGTCCTGGACGAACTCGAGTTCGTCCAGGACGTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-457s1c1
Sequence:CCGGCCAGAGTTTCGCTGTCCTGTACTCGAGTACAGGACAGCGAAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000606.1-325s1c1
Sequence:CCGGCTTCCGAAAGCTGGATGGGATCTCGAGATCCCATCCAGCTTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027062
C8G MISSION shRNA Bacterial Glycerol Stock
complement component 8, gamma polypeptide
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000335436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-406s21c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-847s21c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-335s21c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-544s21c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027062
C8G MISSION shRNA shRNA Plasmid DNA
complement component 8, gamma polypeptide
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000335436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-406s21c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-847s21c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-335s21c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-544s21c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027062
C8G MISSION shRNA Lentiviral Transduction Particles
complement component 8, gamma polypeptide
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000335436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-406s21c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-847s21c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-335s21c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027062.1-544s21c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130127
VALIDATED
C8G MISSION shRNA Bacterial Glycerol Stock
complement component 8, gamma polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-993s1c1
Sequence:CCGGGCCATCTAGTGGAGAAGCTGTCTCGAGACAGCTTCTCCACTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130127.4-513s1c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-651s1c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-442s1c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-954s1c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130127
VALIDATED
C8G MISSION shRNA shRNA Plasmid DNA
complement component 8, gamma polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-993s1c1
Sequence:CCGGGCCATCTAGTGGAGAAGCTGTCTCGAGACAGCTTCTCCACTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130127.4-513s1c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-651s1c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-442s1c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-954s1c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130127
VALIDATED
C8G MISSION shRNA Lentiviral Transduction Particles
complement component 8, gamma polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067363    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-993s1c1
Sequence:CCGGGCCATCTAGTGGAGAAGCTGTCTCGAGACAGCTTCTCCACTAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130127.4-513s1c1
Sequence:CCGGCTCAGAAGTTTGCAGGGACATCTCGAGATGTCCCTGCAAACTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-651s1c1
Sequence:CCGGGAAAGCTAGATGGGATATGTTCTCGAGAACATATCCCATCTAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-442s1c1
Sequence:CCGGCCAAAGGACTCGAAAGCCTATCTCGAGATAGGCTTTCGAGTCCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:XM_130127.4-954s1c1
Sequence:CCGGCGGACCAATTACACATCCTGACTCGAGTCAGGATGTGTAATTGGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks