EMAIL THIS PAGE TO A FRIEND

C8orf22

chromosome 8 open reading frame 22

86 Gene Product Result for
UniProtKB ID: Q8WWR9, G3V137, Q8WVI1
Gene ID:
chicken(425711) chromosome 2 open reading frame, human C8orf22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007176 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138191 MISSION® esiRNA esiRNA human C8orf22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007176 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123661 predicted 410
2 SASI_Hs01_00123662 predicted 212
3 SASI_Hs01_00123663 predicted 504
4 SASI_Hs01_00123664 predicted 262
5 SASI_Hs01_00123665 predicted 410
6 SASI_Hs01_00123666 predicted 201
7 SASI_Hs01_00123667 predicted 303
8 SASI_Hs01_00123668 predicted 235
9 SASI_Hs01_00123669 predicted 402
10 SASI_Hs01_00123670 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007176
C8orf22 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 22
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-256s1c1
Sequence:CCGGGTTCTTTAACTAGCTCTGATTCTCGAGAATCAGAGCTAGTTAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-214s1c1
Sequence:CCGGCCAGAAATCAGTATTATCGAACTCGAGTTCGATAATACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-275s21c1
Sequence:CCGGCTGATTCTGTTAACTTCATAGCTCGAGCTATGAAGTTAACAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007176.3-1046s21c1
Sequence:CCGGTAGCATAATACACCATATATGCTCGAGCATATATGGTGTATTATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-334s21c1
Sequence:CCGGGAATCCACCTGGTGGTTTAAACTCGAGTTTAAACCACCAGGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-213s21c1
Sequence:CCGGTCTAGCCAGAAATCAGTATTACTCGAGTAATACTGATTTCTGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-412s21c1
Sequence:CCGGACTGGCATGAACAGTTGATTCCTCGAGGAATCAACTGTTCATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007176
C8orf22 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 22
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-256s1c1
Sequence:CCGGGTTCTTTAACTAGCTCTGATTCTCGAGAATCAGAGCTAGTTAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-214s1c1
Sequence:CCGGCCAGAAATCAGTATTATCGAACTCGAGTTCGATAATACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-275s21c1
Sequence:CCGGCTGATTCTGTTAACTTCATAGCTCGAGCTATGAAGTTAACAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007176.3-1046s21c1
Sequence:CCGGTAGCATAATACACCATATATGCTCGAGCATATATGGTGTATTATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-334s21c1
Sequence:CCGGGAATCCACCTGGTGGTTTAAACTCGAGTTTAAACCACCAGGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-213s21c1
Sequence:CCGGTCTAGCCAGAAATCAGTATTACTCGAGTAATACTGATTTCTGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-412s21c1
Sequence:CCGGACTGGCATGAACAGTTGATTCCTCGAGGAATCAACTGTTCATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007176
C8orf22 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 22
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-256s1c1
Sequence:CCGGGTTCTTTAACTAGCTCTGATTCTCGAGAATCAGAGCTAGTTAAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166871    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007176.1-214s1c1
Sequence:CCGGCCAGAAATCAGTATTATCGAACTCGAGTTCGATAATACTGATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-275s21c1
Sequence:CCGGCTGATTCTGTTAACTTCATAGCTCGAGCTATGAAGTTAACAGAATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007176.3-1046s21c1
Sequence:CCGGTAGCATAATACACCATATATGCTCGAGCATATATGGTGTATTATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-334s21c1
Sequence:CCGGGAATCCACCTGGTGGTTTAAACTCGAGTTTAAACCACCAGGTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-213s21c1
Sequence:CCGGTCTAGCCAGAAATCAGTATTACTCGAGTAATACTGATTTCTGGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007176.3-412s21c1
Sequence:CCGGACTGGCATGAACAGTTGATTCCTCGAGGAATCAACTGTTCATGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks