EMAIL THIS PAGE TO A FRIEND

C8orf31

chromosome 8 open reading frame 31

138 Gene Product Result for
Species: Human C8orf31(286122)
UniProtKB ID: Q8N9H6, Q6GMU7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173687 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173687 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061975 predicted 413
2 SASI_Hs01_00061976 predicted 467
3 SASI_Hs01_00061977 predicted 428
4 SASI_Hs01_00061978 predicted 476
5 SASI_Hs01_00061979 predicted 461
6 SASI_Hs01_00061980 predicted 425
7 SASI_Hs01_00061981 predicted 408
8 SASI_Hs01_00061982 predicted 408
9 SASI_Hs01_00061983 predicted 461
10 SASI_Hs01_00061984 predicted 513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173687
C8orf31 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173687.1-383s1c1
Sequence:CCGGCAATTCAGTGAGGCAGCTCTTCTCGAGAAGAGCTGCCTCACTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-880s1c1
Sequence:CCGGGCTGATCTGGAAGACAAGTAACTCGAGTTACTTGTCTTCCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-971s1c1
Sequence:CCGGGAAGCGATGAACCATACTGTTCTCGAGAACAGTATGGTTCATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1195s1c1
Sequence:CCGGCCTCTTAACGATCAACGGTAACTCGAGTTACCGTTGATCGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1233s1c1
Sequence:CCGGGAGAAATGCTTTCTTAGCATACTCGAGTATGCTAAGAAAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-883s1c1
Sequence:CCGGGATCTGGAAGACAAGTAACATCTCGAGATGTTACTTGTCTTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1528s1c1
Sequence:CCGGCCTTTAATCACTCTAGCTCAACTCGAGTTGAGCTAGAGTGATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1527s1c1
Sequence:CCGGGCCTTTAATCACTCTAGCTCACTCGAGTGAGCTAGAGTGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1139s1c1
Sequence:CCGGCAACCGTCAATACAAAGGGATCTCGAGATCCCTTTGTATTGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1194s1c1
Sequence:CCGGCCCTCTTAACGATCAACGGTACTCGAGTACCGTTGATCGTTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173687
C8orf31 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173687.1-383s1c1
Sequence:CCGGCAATTCAGTGAGGCAGCTCTTCTCGAGAAGAGCTGCCTCACTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-880s1c1
Sequence:CCGGGCTGATCTGGAAGACAAGTAACTCGAGTTACTTGTCTTCCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-971s1c1
Sequence:CCGGGAAGCGATGAACCATACTGTTCTCGAGAACAGTATGGTTCATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1195s1c1
Sequence:CCGGCCTCTTAACGATCAACGGTAACTCGAGTTACCGTTGATCGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1233s1c1
Sequence:CCGGGAGAAATGCTTTCTTAGCATACTCGAGTATGCTAAGAAAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-883s1c1
Sequence:CCGGGATCTGGAAGACAAGTAACATCTCGAGATGTTACTTGTCTTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1528s1c1
Sequence:CCGGCCTTTAATCACTCTAGCTCAACTCGAGTTGAGCTAGAGTGATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1527s1c1
Sequence:CCGGGCCTTTAATCACTCTAGCTCACTCGAGTGAGCTAGAGTGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1139s1c1
Sequence:CCGGCAACCGTCAATACAAAGGGATCTCGAGATCCCTTTGTATTGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1194s1c1
Sequence:CCGGCCCTCTTAACGATCAACGGTACTCGAGTACCGTTGATCGTTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173687
C8orf31 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173687.1-383s1c1
Sequence:CCGGCAATTCAGTGAGGCAGCTCTTCTCGAGAAGAGCTGCCTCACTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163769    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-880s1c1
Sequence:CCGGGCTGATCTGGAAGACAAGTAACTCGAGTTACTTGTCTTCCAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162957    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-971s1c1
Sequence:CCGGGAAGCGATGAACCATACTGTTCTCGAGAACAGTATGGTTCATCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162781    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1195s1c1
Sequence:CCGGCCTCTTAACGATCAACGGTAACTCGAGTTACCGTTGATCGTTAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159655    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1233s1c1
Sequence:CCGGGAGAAATGCTTTCTTAGCATACTCGAGTATGCTAAGAAAGCATTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161297    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-883s1c1
Sequence:CCGGGATCTGGAAGACAAGTAACATCTCGAGATGTTACTTGTCTTCCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1528s1c1
Sequence:CCGGCCTTTAATCACTCTAGCTCAACTCGAGTTGAGCTAGAGTGATTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162868    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1527s1c1
Sequence:CCGGGCCTTTAATCACTCTAGCTCACTCGAGTGAGCTAGAGTGATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163615    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1139s1c1
Sequence:CCGGCAACCGTCAATACAAAGGGATCTCGAGATCCCTTTGTATTGACGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173687.1-1194s1c1
Sequence:CCGGCCCTCTTAACGATCAACGGTACTCGAGTACCGTTGATCGTTAAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks