EMAIL THIS PAGE TO A FRIEND

C8orf33

chromosome 8 open reading frame 33

140 Gene Product Result for
Species: Human C8orf33(65265)
UniProtKB ID: Q9H7E9, A6NGC0, Q96BT8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023080 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003521 MISSION® esiRNA esiRNA targeting human C8orf33 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023080 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216373 predicted 465
2 SASI_Hs01_00216374 predicted 1201
3 SASI_Hs01_00216375 predicted 1037
4 SASI_Hs01_00216376 predicted 993
5 SASI_Hs01_00216378 predicted 1156
6 SASI_Hs01_00216379 predicted 999
7 SASI_Hs01_00216380 predicted 1030
8 SASI_Hs01_00216381 predicted 1018
9 SASI_Hs01_00216382 predicted 1134
10 SASI_Hs02_00356329 predicted 819
11 SASI_Hs01_00216377 predicted 930
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023080
VALIDATED
C8orf33 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 33
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-678s1c1
Sequence:CCGGCTATATGGAGAGCCAAAGCCACTCGAGTGGCTTTGGCTCTCCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1222s1c1
Sequence:CCGGCCACCTATGTTAGAGGAAGTACTCGAGTACTTCCTCTAACATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-530s1c1
Sequence:CCGGCACTCCTTGTTTGGAGACTATCTCGAGATAGTCTCCAAACAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-447s1c1
Sequence:CCGGCGAAACAGAAAGAGCAGGCTACTCGAGTAGCCTGCTCTTTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-713s1c1
Sequence:CCGGGATGAAGAGTTTAGGTTCAATCTCGAGATTGAACCTAAACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-521s1c1
Sequence:CCGGCAGCTGATGCACTCCTTGTTTCTCGAGAAACAAGGAGTGCATCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-2280s1c1
Sequence:CCGGGCTTTCATGTTCCATCCTGTACTCGAGTACAGGATGGAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1499s1c1
Sequence:CCGGCCAGGTGACCTAATCCTCATTCTCGAGAATGAGGATTAGGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-665s21c1
Sequence:CCGGTCTGCAGGCCTCGCTCTATATCTCGAGATATAGAGCGAGGCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-190s21c1
Sequence:CCGGGAGCAACCTACGTGCAGTAACCTCGAGGTTACTGCACGTAGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-631s21c1
Sequence:CCGGGTAGATGGAGCCACCAGAAAGCTCGAGCTTTCTGGTGGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1037s21c1
Sequence:CCGGCAGTCTTTAGGATTAGATTAACTCGAGTTAATCTAATCCTAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-594s21c1
Sequence:CCGGTCTCAGAGCTGCTGCTTATTCCTCGAGGAATAAGCAGCAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1135s21c1
Sequence:CCGGCAAATGGTTTAGTGCTTAATGCTCGAGCATTAAGCACTAAACCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023080
VALIDATED
C8orf33 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 33
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-678s1c1
Sequence:CCGGCTATATGGAGAGCCAAAGCCACTCGAGTGGCTTTGGCTCTCCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1222s1c1
Sequence:CCGGCCACCTATGTTAGAGGAAGTACTCGAGTACTTCCTCTAACATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-530s1c1
Sequence:CCGGCACTCCTTGTTTGGAGACTATCTCGAGATAGTCTCCAAACAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-447s1c1
Sequence:CCGGCGAAACAGAAAGAGCAGGCTACTCGAGTAGCCTGCTCTTTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-713s1c1
Sequence:CCGGGATGAAGAGTTTAGGTTCAATCTCGAGATTGAACCTAAACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-521s1c1
Sequence:CCGGCAGCTGATGCACTCCTTGTTTCTCGAGAAACAAGGAGTGCATCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-2280s1c1
Sequence:CCGGGCTTTCATGTTCCATCCTGTACTCGAGTACAGGATGGAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1499s1c1
Sequence:CCGGCCAGGTGACCTAATCCTCATTCTCGAGAATGAGGATTAGGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-665s21c1
Sequence:CCGGTCTGCAGGCCTCGCTCTATATCTCGAGATATAGAGCGAGGCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-190s21c1
Sequence:CCGGGAGCAACCTACGTGCAGTAACCTCGAGGTTACTGCACGTAGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-631s21c1
Sequence:CCGGGTAGATGGAGCCACCAGAAAGCTCGAGCTTTCTGGTGGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1037s21c1
Sequence:CCGGCAGTCTTTAGGATTAGATTAACTCGAGTTAATCTAATCCTAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-594s21c1
Sequence:CCGGTCTCAGAGCTGCTGCTTATTCCTCGAGGAATAAGCAGCAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1135s21c1
Sequence:CCGGCAAATGGTTTAGTGCTTAATGCTCGAGCATTAAGCACTAAACCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023080
VALIDATED
C8orf33 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 33
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-678s1c1
Sequence:CCGGCTATATGGAGAGCCAAAGCCACTCGAGTGGCTTTGGCTCTCCATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162446    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1222s1c1
Sequence:CCGGCCACCTATGTTAGAGGAAGTACTCGAGTACTTCCTCTAACATAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-530s1c1
Sequence:CCGGCACTCCTTGTTTGGAGACTATCTCGAGATAGTCTCCAAACAAGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-447s1c1
Sequence:CCGGCGAAACAGAAAGAGCAGGCTACTCGAGTAGCCTGCTCTTTCTGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_023080.1-713s1c1
Sequence:CCGGGATGAAGAGTTTAGGTTCAATCTCGAGATTGAACCTAAACTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023080.1-521s1c1
Sequence:CCGGCAGCTGATGCACTCCTTGTTTCTCGAGAAACAAGGAGTGCATCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-2280s1c1
Sequence:CCGGGCTTTCATGTTCCATCCTGTACTCGAGTACAGGATGGAACATGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023080.1-1499s1c1
Sequence:CCGGCCAGGTGACCTAATCCTCATTCTCGAGAATGAGGATTAGGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-665s21c1
Sequence:CCGGTCTGCAGGCCTCGCTCTATATCTCGAGATATAGAGCGAGGCCTGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-190s21c1
Sequence:CCGGGAGCAACCTACGTGCAGTAACCTCGAGGTTACTGCACGTAGGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-631s21c1
Sequence:CCGGGTAGATGGAGCCACCAGAAAGCTCGAGCTTTCTGGTGGCTCCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1037s21c1
Sequence:CCGGCAGTCTTTAGGATTAGATTAACTCGAGTTAATCTAATCCTAAAGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-594s21c1
Sequence:CCGGTCTCAGAGCTGCTGCTTATTCCTCGAGGAATAAGCAGCAGCTCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369540    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_023080.2-1135s21c1
Sequence:CCGGCAAATGGTTTAGTGCTTAATGCTCGAGCATTAAGCACTAAACCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks