EMAIL THIS PAGE TO A FRIEND

C8orf34

chromosome 8 open reading frame 34

Synonyms: VEST-1 VEST1
Gene ID:
chicken(768864) chromosome 2 open reading frame, human C8orf34
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052958 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114261 MISSION® esiRNA esiRNA human C8orf34 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052958 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021330 predicted 2806
2 SASI_Hs01_00021331 predicted 1974
3 SASI_Hs01_00021332 predicted 2350
4 SASI_Hs01_00021333 predicted 2518
5 SASI_Hs01_00021334 predicted 1743
6 SASI_Hs01_00021335 predicted 1762
7 SASI_Hs01_00021336 predicted 2883
8 SASI_Hs02_00361762 predicted 2396
9 SASI_Hs01_00021337 predicted 1899
10 SASI_Hs01_00021338 predicted 2000
11 SASI_Hs01_00021339 predicted 1862
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052958
C8orf34 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 34
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052958.1-2888s21c1
Sequence:CCGGGAAGTTGCAAGTGGTCCTTAACTCGAGTTAAGGACCACTTGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-1769s21c1
Sequence:CCGGTGATAAACCTTGGCAATTAAACTCGAGTTTAATTGCCAAGGTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-2355s21c1
Sequence:CCGGGAATTGCTGGAGGATCTTAATCTCGAGATTAAGATCCTCCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1906s1c1
Sequence:CCGGCTAAACCACAAAGCCGTGATTCTCGAGAATCACGGCTTTGTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052958.1-3047s1c1
Sequence:CCGGGAGAACACTAATCCTGGCAAACTCGAGTTTGCCAGGATTAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1632s1c1
Sequence:CCGGCCATTTCTCATTGACCATCTTCTCGAGAAGATGGTCAATGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2814s1c1
Sequence:CCGGGCTGATCTTCTTCTTTGCGTTCTCGAGAACGCAAAGAAGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1739s1c1
Sequence:CCGGCAAAGGAACAAGAAGGGATTTCTCGAGAAATCCCTTCTTGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1631s1c1
Sequence:CCGGCCCATTTCTCATTGACCATCTCTCGAGAGATGGTCAATGAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2573s1c1
Sequence:CCGGCCCAGATTCATTCGATTCCTTCTCGAGAAGGAATCGAATGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052958.1-3399s1c1
Sequence:CCGGCCACTGCTCTTTCTCATGATTCTCGAGAATCATGAGAAAGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052958
C8orf34 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 34
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052958.1-2888s21c1
Sequence:CCGGGAAGTTGCAAGTGGTCCTTAACTCGAGTTAAGGACCACTTGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-1769s21c1
Sequence:CCGGTGATAAACCTTGGCAATTAAACTCGAGTTTAATTGCCAAGGTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-2355s21c1
Sequence:CCGGGAATTGCTGGAGGATCTTAATCTCGAGATTAAGATCCTCCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1906s1c1
Sequence:CCGGCTAAACCACAAAGCCGTGATTCTCGAGAATCACGGCTTTGTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052958.1-3047s1c1
Sequence:CCGGGAGAACACTAATCCTGGCAAACTCGAGTTTGCCAGGATTAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1632s1c1
Sequence:CCGGCCATTTCTCATTGACCATCTTCTCGAGAAGATGGTCAATGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2814s1c1
Sequence:CCGGGCTGATCTTCTTCTTTGCGTTCTCGAGAACGCAAAGAAGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1739s1c1
Sequence:CCGGCAAAGGAACAAGAAGGGATTTCTCGAGAAATCCCTTCTTGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1631s1c1
Sequence:CCGGCCCATTTCTCATTGACCATCTCTCGAGAGATGGTCAATGAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2573s1c1
Sequence:CCGGCCCAGATTCATTCGATTCCTTCTCGAGAAGGAATCGAATGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052958.1-3399s1c1
Sequence:CCGGCCACTGCTCTTTCTCATGATTCTCGAGAATCATGAGAAAGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052958
C8orf34 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 34
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052958.1-2888s21c1
Sequence:CCGGGAAGTTGCAAGTGGTCCTTAACTCGAGTTAAGGACCACTTGCAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-1769s21c1
Sequence:CCGGTGATAAACCTTGGCAATTAAACTCGAGTTTAATTGCCAAGGTTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052958.1-2355s21c1
Sequence:CCGGGAATTGCTGGAGGATCTTAATCTCGAGATTAAGATCCTCCAGCAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1906s1c1
Sequence:CCGGCTAAACCACAAAGCCGTGATTCTCGAGAATCACGGCTTTGTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127702    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052958.1-3047s1c1
Sequence:CCGGGAGAACACTAATCCTGGCAAACTCGAGTTTGCCAGGATTAGTGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-1632s1c1
Sequence:CCGGCCATTTCTCATTGACCATCTTCTCGAGAAGATGGTCAATGAGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2814s1c1
Sequence:CCGGGCTGATCTTCTTCTTTGCGTTCTCGAGAACGCAAAGAAGAAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147468    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1739s1c1
Sequence:CCGGCAAAGGAACAAGAAGGGATTTCTCGAGAAATCCCTTCTTGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052958.1-1631s1c1
Sequence:CCGGCCCATTTCTCATTGACCATCTCTCGAGAGATGGTCAATGAGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052958.1-2573s1c1
Sequence:CCGGCCCAGATTCATTCGATTCCTTCTCGAGAAGGAATCGAATGAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148404    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_052958.1-3399s1c1
Sequence:CCGGCCACTGCTCTTTCTCATGATTCTCGAGAATCATGAGAAAGAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks