EMAIL THIS PAGE TO A FRIEND

C8orf37

chromosome 8 open reading frame 37

21 Gene Product Result for
Synonyms: CORD16 RP64 smalltalk
Species: Human C8orf37(157657)
UniProtKB ID: Q96NL8
Gene ID:
Human(157657) Summary: This gene encodes a ubiquitously expressed protein of unknown function. It has high levels of mRNA expression in the brain, heart, and retina and the protein co-localizes with polyglutamylated tubulin at the base of the primary cilium in human retinal pigment epithelial cells. Mutations in this gene have been associated with autosomal recessive cone-rod dystrophy (arCRD) and retinitis pigmentosa (arRP). [provided by RefSeq, Mar 2012]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA024198 Anti-C8orf37 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU054531 MISSION® esiRNA esiRNA human C8orf37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177965 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114886 predicted 405
2 SASI_Hs01_00114887 predicted 806
3 SASI_Hs01_00114888 predicted 812
4 SASI_Hs01_00114889 predicted 334
5 SASI_Hs01_00114890 predicted 897
6 SASI_Hs01_00114891 predicted 485
7 SASI_Hs01_00114893 predicted 908
8 SASI_Hs01_00114894 predicted 443
9 SASI_Hs01_00114895 predicted 549
10 SASI_Hs02_00369439 predicted 451
11 SASI_Hs01_00114892 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177965
C8orf37 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 37
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-198s1c1
Sequence:CCGGGAAGATGATCTTGACAGTCTTCTCGAGAAGACTGTCAAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-170s1c1
Sequence:CCGGGCTCAGATCAACAGAAACATTCTCGAGAATGTTTCTGTTGATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-48s1c1
Sequence:CCGGGATGAAGTCGAGTCCAAGTTTCTCGAGAAACTTGGACTCGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-234s1c1
Sequence:CCGGGAAGAGCCCAACTTGGACAAACTCGAGTTTGTCCAAGTTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-304s1c1
Sequence:CCGGCTTCCATTGAAGGCCTTGGTACTCGAGTACCAAGGCCTTCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-563s1c1
Sequence:CCGGCCAGTGTAGCTGGAGAACTATCTCGAGATAGTTCTCCAGCTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1603s1c1
Sequence:CCGGGCCCTACAATAGCAGCACATTCTCGAGAATGTGCTGCTATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1029s1c1
Sequence:CCGGGCCAGGGCAAAGAGATCATTTCTCGAGAAATGATCTCTTTGCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-600s1c1
Sequence:CCGGCTTCAGACAGATCATCAGCTTCTCGAGAAGCTGATGATCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-536s1c1
Sequence:CCGGGAAGAAAGGAACACGGGCATACTCGAGTATGCCCGTGTTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177965
C8orf37 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 37
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-198s1c1
Sequence:CCGGGAAGATGATCTTGACAGTCTTCTCGAGAAGACTGTCAAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-170s1c1
Sequence:CCGGGCTCAGATCAACAGAAACATTCTCGAGAATGTTTCTGTTGATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-48s1c1
Sequence:CCGGGATGAAGTCGAGTCCAAGTTTCTCGAGAAACTTGGACTCGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-234s1c1
Sequence:CCGGGAAGAGCCCAACTTGGACAAACTCGAGTTTGTCCAAGTTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-304s1c1
Sequence:CCGGCTTCCATTGAAGGCCTTGGTACTCGAGTACCAAGGCCTTCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-563s1c1
Sequence:CCGGCCAGTGTAGCTGGAGAACTATCTCGAGATAGTTCTCCAGCTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1603s1c1
Sequence:CCGGGCCCTACAATAGCAGCACATTCTCGAGAATGTGCTGCTATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1029s1c1
Sequence:CCGGGCCAGGGCAAAGAGATCATTTCTCGAGAAATGATCTCTTTGCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-600s1c1
Sequence:CCGGCTTCAGACAGATCATCAGCTTCTCGAGAAGCTGATGATCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-536s1c1
Sequence:CCGGGAAGAAAGGAACACGGGCATACTCGAGTATGCCCGTGTTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177965
C8orf37 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 37
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-198s1c1
Sequence:CCGGGAAGATGATCTTGACAGTCTTCTCGAGAAGACTGTCAAGATCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-170s1c1
Sequence:CCGGGCTCAGATCAACAGAAACATTCTCGAGAATGTTTCTGTTGATCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-48s1c1
Sequence:CCGGGATGAAGTCGAGTCCAAGTTTCTCGAGAAACTTGGACTCGACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139392    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-234s1c1
Sequence:CCGGGAAGAGCCCAACTTGGACAAACTCGAGTTTGTCCAAGTTGGGCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-304s1c1
Sequence:CCGGCTTCCATTGAAGGCCTTGGTACTCGAGTACCAAGGCCTTCAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177965.2-563s1c1
Sequence:CCGGCCAGTGTAGCTGGAGAACTATCTCGAGATAGTTCTCCAGCTACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139935    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1603s1c1
Sequence:CCGGGCCCTACAATAGCAGCACATTCTCGAGAATGTGCTGCTATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177965.2-1029s1c1
Sequence:CCGGGCCAGGGCAAAGAGATCATTTCTCGAGAAATGATCTCTTTGCCCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142931    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-600s1c1
Sequence:CCGGCTTCAGACAGATCATCAGCTTCTCGAGAAGCTGATGATCTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177965.2-536s1c1
Sequence:CCGGGAAGAAAGGAACACGGGCATACTCGAGTATGCCCGTGTTCCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks