EMAIL THIS PAGE TO A FRIEND

C8orf44

chromosome 8 open reading frame 44

61 Gene Product Result for
Species: Human C8orf44(56260)
UniProtKB ID: Q96CB5, Q9NUM6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019607 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019607 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064320 predicted 558
2 SASI_Hs01_00064321 predicted 1122
3 SASI_Hs01_00064322 predicted 1206
4 SASI_Hs01_00064323 predicted 650
5 SASI_Hs01_00064324 predicted 1148
6 SASI_Hs01_00064325 predicted 728
7 SASI_Hs01_00064326 predicted 1259
8 SASI_Hs02_00352822 predicted 651
9 SASI_Hs01_00064327 predicted 1147
10 SASI_Hs01_00064328 predicted 1214
11 SASI_Hs01_00064329 predicted 346
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019607
C8orf44 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 44
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-658s1c1
Sequence:CCGGCCAGATGTACCGAGTTTGAAACTCGAGTTTCAAACTCGGTACATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-668s1c1
Sequence:CCGGCGAGTTTGAAATCCCAGAAGCCTCGAGGCTTCTGGGATTTCAAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019607.1-1098s1c1
Sequence:CCGGCCACTGACACACAAGCACTAACTCGAGTTAGTGCTTGTGTGTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-726s1c1
Sequence:CCGGCAAAGGCTTCTGGAGTCTTCTCTCGAGAGAAGACTCCAGAAGCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-654s1c1
Sequence:CCGGGAGACCAGATGTACCGAGTTTCTCGAGAAACTCGGTACATCTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-656s1c1
Sequence:CCGGGACCAGATGTACCGAGTTTGACTCGAGTCAAACTCGGTACATCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-664s1c1
Sequence:CCGGGTACCGAGTTTGAAATCCCAGCTCGAGCTGGGATTTCAAACTCGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-731s1c1
Sequence:CCGGGCTTCTGGAGTCTTCTGTTCTCTCGAGAGAACAGAAGACTCCAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-1509s1c1
Sequence:CCGGGCCTCATCTCTTCTGAGGTTTCTCGAGAAACCTCAGAAGAGATGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-934s1c1
Sequence:CCGGCGGACATGATACTCTTAGCTTCTCGAGAAGCTAAGAGTATCATGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-735s1c1
Sequence:CCGGCTGGAGTCTTCTGTTCTCTAACTCGAGTTAGAGAACAGAAGACTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-553s1c1
Sequence:CCGGCTGAATTATCAGTCTCTCATTCTCGAGAATGAGAGACTGATAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019607
C8orf44 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 44
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-658s1c1
Sequence:CCGGCCAGATGTACCGAGTTTGAAACTCGAGTTTCAAACTCGGTACATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-668s1c1
Sequence:CCGGCGAGTTTGAAATCCCAGAAGCCTCGAGGCTTCTGGGATTTCAAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019607.1-1098s1c1
Sequence:CCGGCCACTGACACACAAGCACTAACTCGAGTTAGTGCTTGTGTGTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-726s1c1
Sequence:CCGGCAAAGGCTTCTGGAGTCTTCTCTCGAGAGAAGACTCCAGAAGCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-654s1c1
Sequence:CCGGGAGACCAGATGTACCGAGTTTCTCGAGAAACTCGGTACATCTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-656s1c1
Sequence:CCGGGACCAGATGTACCGAGTTTGACTCGAGTCAAACTCGGTACATCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-664s1c1
Sequence:CCGGGTACCGAGTTTGAAATCCCAGCTCGAGCTGGGATTTCAAACTCGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-731s1c1
Sequence:CCGGGCTTCTGGAGTCTTCTGTTCTCTCGAGAGAACAGAAGACTCCAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-1509s1c1
Sequence:CCGGGCCTCATCTCTTCTGAGGTTTCTCGAGAAACCTCAGAAGAGATGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-934s1c1
Sequence:CCGGCGGACATGATACTCTTAGCTTCTCGAGAAGCTAAGAGTATCATGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-735s1c1
Sequence:CCGGCTGGAGTCTTCTGTTCTCTAACTCGAGTTAGAGAACAGAAGACTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-553s1c1
Sequence:CCGGCTGAATTATCAGTCTCTCATTCTCGAGAATGAGAGACTGATAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019607
C8orf44 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 44
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-658s1c1
Sequence:CCGGCCAGATGTACCGAGTTTGAAACTCGAGTTTCAAACTCGGTACATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139298    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-668s1c1
Sequence:CCGGCGAGTTTGAAATCCCAGAAGCCTCGAGGCTTCTGGGATTTCAAACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019607.1-1098s1c1
Sequence:CCGGCCACTGACACACAAGCACTAACTCGAGTTAGTGCTTGTGTGTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-726s1c1
Sequence:CCGGCAAAGGCTTCTGGAGTCTTCTCTCGAGAGAAGACTCCAGAAGCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-654s1c1
Sequence:CCGGGAGACCAGATGTACCGAGTTTCTCGAGAAACTCGGTACATCTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-656s1c1
Sequence:CCGGGACCAGATGTACCGAGTTTGACTCGAGTCAAACTCGGTACATCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140234    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-664s1c1
Sequence:CCGGGTACCGAGTTTGAAATCCCAGCTCGAGCTGGGATTTCAAACTCGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140530    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019607.1-731s1c1
Sequence:CCGGGCTTCTGGAGTCTTCTGTTCTCTCGAGAGAACAGAAGACTCCAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140576    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-1509s1c1
Sequence:CCGGGCCTCATCTCTTCTGAGGTTTCTCGAGAAACCTCAGAAGAGATGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019607.1-934s1c1
Sequence:CCGGCGGACATGATACTCTTAGCTTCTCGAGAAGCTAAGAGTATCATGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-735s1c1
Sequence:CCGGCTGGAGTCTTCTGTTCTCTAACTCGAGTTAGAGAACAGAAGACTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019607.1-553s1c1
Sequence:CCGGCTGAATTATCAGTCTCTCATTCTCGAGAATGAGAGACTGATAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)