EMAIL THIS PAGE TO A FRIEND

C8orf46

chromosome 8 open reading frame 46

Species: Human C8orf46(254778)
UniProtKB ID: Q8TAG6, B2RDC3, B4DFU4, C9J814, C9JCS3
Gene ID:
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152765 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004791 MISSION® esiRNA esiRNA targeting human C8orf46 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152765 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165415 predicted 1133
2 SASI_Hs01_00165416 predicted 733
3 SASI_Hs01_00165417 predicted 228
4 SASI_Hs01_00165418 predicted 893
5 SASI_Hs02_00366703 predicted 1148
6 SASI_Hs01_00165419 predicted 851
7 SASI_Hs01_00165421 predicted 1080
8 SASI_Hs01_00165422 predicted 684
9 SASI_Hs01_00165423 predicted 869
10 SASI_Hs02_00366704 predicted 695
11 SASI_Hs01_00165414 predicted 1125
12 SASI_Hs01_00165420 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152765
VALIDATED
C8orf46 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 46
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-196s1c1
Sequence:CCGGCCAGCCAGAAGAAGAGCCAAACTCGAGTTTGGCTCTTCTTCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-685s1c1
Sequence:CCGGCACAAGAAGAAGTCTGAATATCTCGAGATATTCAGACTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-560s1c1
Sequence:CCGGCCAGACATCTCAAGAAGATGACTCGAGTCATCTTCTTGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-231s1c1
Sequence:CCGGCTTGACCAAGAATGTGGTGATCTCGAGATCACCACATTCTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-225s1c1
Sequence:CCGGGCACCTCTTGACCAAGAATGTCTCGAGACATTCTTGGTCAAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-552s1c1
Sequence:CCGGGAGAGGATCCAGACATCTCAACTCGAGTTGAGATGTCTGGATCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-223s1c1
Sequence:CCGGCAGCACCTCTTGACCAAGAATCTCGAGATTCTTGGTCAAGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-570s1c1
Sequence:CCGGCAAGAAGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-1130s1c1
Sequence:CCGGGCACTTGTAAACACAATGGTTCTCGAGAACCATTGTGTTTACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152765
VALIDATED
C8orf46 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 46
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-196s1c1
Sequence:CCGGCCAGCCAGAAGAAGAGCCAAACTCGAGTTTGGCTCTTCTTCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-685s1c1
Sequence:CCGGCACAAGAAGAAGTCTGAATATCTCGAGATATTCAGACTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-560s1c1
Sequence:CCGGCCAGACATCTCAAGAAGATGACTCGAGTCATCTTCTTGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-231s1c1
Sequence:CCGGCTTGACCAAGAATGTGGTGATCTCGAGATCACCACATTCTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-225s1c1
Sequence:CCGGGCACCTCTTGACCAAGAATGTCTCGAGACATTCTTGGTCAAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-552s1c1
Sequence:CCGGGAGAGGATCCAGACATCTCAACTCGAGTTGAGATGTCTGGATCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-223s1c1
Sequence:CCGGCAGCACCTCTTGACCAAGAATCTCGAGATTCTTGGTCAAGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-570s1c1
Sequence:CCGGCAAGAAGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-1130s1c1
Sequence:CCGGGCACTTGTAAACACAATGGTTCTCGAGAACCATTGTGTTTACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152765
VALIDATED
C8orf46 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 46
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-196s1c1
Sequence:CCGGCCAGCCAGAAGAAGAGCCAAACTCGAGTTTGGCTCTTCTTCTGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-685s1c1
Sequence:CCGGCACAAGAAGAAGTCTGAATATCTCGAGATATTCAGACTTCTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-560s1c1
Sequence:CCGGCCAGACATCTCAAGAAGATGACTCGAGTCATCTTCTTGAGATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-231s1c1
Sequence:CCGGCTTGACCAAGAATGTGGTGATCTCGAGATCACCACATTCTTGGTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152765.2-225s1c1
Sequence:CCGGGCACCTCTTGACCAAGAATGTCTCGAGACATTCTTGGTCAAGAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-552s1c1
Sequence:CCGGGAGAGGATCCAGACATCTCAACTCGAGTTGAGATGTCTGGATCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-223s1c1
Sequence:CCGGCAGCACCTCTTGACCAAGAATCTCGAGATTCTTGGTCAAGAGGTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145558    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152765.2-570s1c1
Sequence:CCGGCAAGAAGATGACTGAAGAGTACTCGAGTACTCTTCAGTCATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_152765.2-1130s1c1
Sequence:CCGGGCACTTGTAAACACAATGGTTCTCGAGAACCATTGTGTTTACAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks