EMAIL THIS PAGE TO A FRIEND

C8orf47

chromosome 8 open reading frame 47

32 Gene Product Result for
Species: Human C8orf47(203111)
UniProtKB ID: Q6P6B1, G3V1K4, Q8N1L8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173549 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042701 MISSION® esiRNA esiRNA human C8orf47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173549 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023141 predicted 978
2 SASI_Hs01_00023142 predicted 683
3 SASI_Hs01_00023143 predicted 1291
4 SASI_Hs01_00023144 predicted 688
5 SASI_Hs01_00023145 predicted 719
6 SASI_Hs01_00023146 predicted 936
7 SASI_Hs01_00023147 predicted 1323
8 SASI_Hs01_00023149 predicted 1260
9 SASI_Hs02_00368356 predicted 1025
10 SASI_Hs02_00368357 predicted 1271
11 SASI_Hs01_00023148 predicted 702
12 SASI_Hs01_00023150 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173549
VALIDATED
C8orf47 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 47
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173549.1-524s1c1
Sequence:CCGGGCAGCAGAAGGAAAGAAGAAACTCGAGTTTCTTCTTTCCTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173549.1-202s1c1
Sequence:CCGGCAGCGTAACTTCAAATGAGCACTCGAGTGCTCATTTGAAGTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-287s1c1
Sequence:CCGGGAATCTACTGTTGATGGCAATCTCGAGATTGCCATCAACAGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-724s1c1
Sequence:CCGGGAACGTTCTGACTCTGCAAATCTCGAGATTTGCAGAGTCAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-1139s1c1
Sequence:CCGGGAAGAGGACCAACGCATTGAACTCGAGTTCAATGCGTTGGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-359s1c1
Sequence:CCGGCCTACAGCTAATGGTGTTAAACTCGAGTTTAACACCATTAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-559s21c1
Sequence:CCGGGACAGAGGCCGAGTCTCTAAACTCGAGTTTAGAGACTCGGCCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173549.2-1322s21c1
Sequence:CCGGGGTAGTGAAGCTTGTGGTTATCTCGAGATAACCACAAGCTTCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-670s21c1
Sequence:CCGGGGTCACTGAGAATCCACAAACCTCGAGGTTTGTGGATTCTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-1070s21c1
Sequence:CCGGATGGAGCATCCAGCACGAAATCTCGAGATTTCGTGCTGGATGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173549
VALIDATED
C8orf47 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 47
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173549.1-524s1c1
Sequence:CCGGGCAGCAGAAGGAAAGAAGAAACTCGAGTTTCTTCTTTCCTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173549.1-202s1c1
Sequence:CCGGCAGCGTAACTTCAAATGAGCACTCGAGTGCTCATTTGAAGTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-287s1c1
Sequence:CCGGGAATCTACTGTTGATGGCAATCTCGAGATTGCCATCAACAGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-724s1c1
Sequence:CCGGGAACGTTCTGACTCTGCAAATCTCGAGATTTGCAGAGTCAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-1139s1c1
Sequence:CCGGGAAGAGGACCAACGCATTGAACTCGAGTTCAATGCGTTGGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-359s1c1
Sequence:CCGGCCTACAGCTAATGGTGTTAAACTCGAGTTTAACACCATTAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-559s21c1
Sequence:CCGGGACAGAGGCCGAGTCTCTAAACTCGAGTTTAGAGACTCGGCCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173549.2-1322s21c1
Sequence:CCGGGGTAGTGAAGCTTGTGGTTATCTCGAGATAACCACAAGCTTCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-670s21c1
Sequence:CCGGGGTCACTGAGAATCCACAAACCTCGAGGTTTGTGGATTCTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-1070s21c1
Sequence:CCGGATGGAGCATCCAGCACGAAATCTCGAGATTTCGTGCTGGATGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173549
VALIDATED
C8orf47 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 47
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173549.1-524s1c1
Sequence:CCGGGCAGCAGAAGGAAAGAAGAAACTCGAGTTTCTTCTTTCCTTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173549.1-202s1c1
Sequence:CCGGCAGCGTAACTTCAAATGAGCACTCGAGTGCTCATTTGAAGTTACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-287s1c1
Sequence:CCGGGAATCTACTGTTGATGGCAATCTCGAGATTGCCATCAACAGTAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-724s1c1
Sequence:CCGGGAACGTTCTGACTCTGCAAATCTCGAGATTTGCAGAGTCAGAACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-1139s1c1
Sequence:CCGGGAAGAGGACCAACGCATTGAACTCGAGTTCAATGCGTTGGTCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_173549.1-359s1c1
Sequence:CCGGCCTACAGCTAATGGTGTTAAACTCGAGTTTAACACCATTAGCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-559s21c1
Sequence:CCGGGACAGAGGCCGAGTCTCTAAACTCGAGTTTAGAGACTCGGCCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173549.2-1322s21c1
Sequence:CCGGGGTAGTGAAGCTTGTGGTTATCTCGAGATAACCACAAGCTTCACTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-670s21c1
Sequence:CCGGGGTCACTGAGAATCCACAAACCTCGAGGTTTGTGGATTCTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173549.2-1070s21c1
Sequence:CCGGATGGAGCATCCAGCACGAAATCTCGAGATTTCGTGCTGGATGCTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks