EMAIL THIS PAGE TO A FRIEND

C8orf48

chromosome 8 open reading frame 48

51 Gene Product Result for
Species: Human C8orf48(157773)
UniProtKB ID: Q96LL4, Q96LJ9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007090 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051421 MISSION® esiRNA esiRNA human C8orf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007090 Rosetta Predictions human pricing
XR_017961 Rosetta Predictions human pricing
XR_042053 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016656 predicted 834
2 SASI_Hs01_00016657 predicted 521
3 SASI_Hs01_00016658 predicted 428
4 SASI_Hs01_00016659 predicted 962
5 SASI_Hs01_00016660 predicted 808
6 SASI_Hs01_00016661 predicted 456
7 SASI_Hs01_00016662 predicted 231
8 SASI_Hs01_00016663 predicted 252
9 SASI_Hs01_00016664 predicted 249
10 SASI_Hs01_00016665 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495087 predicted 832
2 SASI_Hs02_00495088 predicted 510
3 SASI_Hs02_00495089 predicted 424
4 SASI_Hs02_00495090 predicted 955
5 SASI_Hs02_00495091 predicted 804
6 SASI_Hs02_00495092 predicted 452
7 SASI_Hs02_00495093 predicted 221
8 SASI_Hs02_00495094 predicted 253
9 SASI_Hs02_00495095 predicted 237
10 SASI_Hs02_00495096 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00532667 predicted 832
2 SASI_Hs02_00532668 predicted 512
3 SASI_Hs02_00532669 predicted 422
4 SASI_Hs02_00532670 predicted 947
5 SASI_Hs02_00532671 predicted 805
6 SASI_Hs02_00532672 predicted 451
7 SASI_Hs02_00532673 predicted 221
8 SASI_Hs02_00532674 predicted 248
9 SASI_Hs02_00532675 predicted 242
10 SASI_Hs02_00532676 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007090
C8orf48 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 48
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1084s21c1
Sequence:CCGGTGGTGATTGTTAATGATAATGCTCGAGCATTATCATTAACAATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-524s21c1
Sequence:CCGGTTGCACCATGAAGATAAATTTCTCGAGAAATTTATCTTCATGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1052s21c1
Sequence:CCGGTCTCAAGCGACTTACTCTAATCTCGAGATTAGAGTAAGTCGCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007090.2-1162s21c1
Sequence:CCGGGCACTTGGGAAACTAACTTAACTCGAGTTAAGTTAGTTTCCCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1013s21c1
Sequence:CCGGTGGAAATAGTGCTTGTCATTTCTCGAGAAATGACAAGCACTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007090.1-1082s1c1
Sequence:CCGGGCTGGTGATTGTTAATGATAACTCGAGTTATCATTAACAATCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007090
C8orf48 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 48
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1084s21c1
Sequence:CCGGTGGTGATTGTTAATGATAATGCTCGAGCATTATCATTAACAATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-524s21c1
Sequence:CCGGTTGCACCATGAAGATAAATTTCTCGAGAAATTTATCTTCATGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1052s21c1
Sequence:CCGGTCTCAAGCGACTTACTCTAATCTCGAGATTAGAGTAAGTCGCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007090.2-1162s21c1
Sequence:CCGGGCACTTGGGAAACTAACTTAACTCGAGTTAAGTTAGTTTCCCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1013s21c1
Sequence:CCGGTGGAAATAGTGCTTGTCATTTCTCGAGAAATGACAAGCACTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007090.1-1082s1c1
Sequence:CCGGGCTGGTGATTGTTAATGATAACTCGAGTTATCATTAACAATCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007090
C8orf48 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 48
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1084s21c1
Sequence:CCGGTGGTGATTGTTAATGATAATGCTCGAGCATTATCATTAACAATCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337068    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-524s21c1
Sequence:CCGGTTGCACCATGAAGATAAATTTCTCGAGAAATTTATCTTCATGGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1052s21c1
Sequence:CCGGTCTCAAGCGACTTACTCTAATCTCGAGATTAGAGTAAGTCGCTTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001007090.2-1162s21c1
Sequence:CCGGGCACTTGGGAAACTAACTTAACTCGAGTTAAGTTAGTTTCCCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001007090.2-1013s21c1
Sequence:CCGGTGGAAATAGTGCTTGTCATTTCTCGAGAAATGACAAGCACTATTTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007090.1-1082s1c1
Sequence:CCGGGCTGGTGATTGTTAATGATAACTCGAGTTATCATTAACAATCACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks