EMAIL THIS PAGE TO A FRIEND

C8orf49

chromosome 8 open reading frame 49

41 Gene Product Result for
Species: Human C8orf49(606553)
UniProtKB ID: Q96NF6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031839 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031839 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031839 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031839 Rosetta Predictions human pricing
XR_040402 Rosetta Predictions human pricing
XR_040403 Rosetta Predictions human pricing
XR_040404 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017144 predicted 1039
2 SASI_Hs01_00017145 predicted 673
3 SASI_Hs01_00017146 predicted 616
4 SASI_Hs01_00017147 predicted 543
5 SASI_Hs01_00017148 predicted 706
6 SASI_Hs01_00017149 predicted 874
7 SASI_Hs01_00017150 predicted 736
8 SASI_Hs01_00017151 predicted 685
9 SASI_Hs01_00017152 predicted 643
10 SASI_Hs01_00017153 predicted 657
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518521 predicted 600
2 SASI_Hs02_00518522 predicted 605
3 SASI_Hs02_00518523 predicted 595
4 SASI_Hs02_00518524 predicted 560
5 SASI_Hs02_00518525 predicted 589
6 SASI_Hs02_00518526 predicted 606
7 SASI_Hs02_00518527 predicted 625
8 SASI_Hs02_00518528 predicted 612
9 SASI_Hs02_00518529 predicted 599
10 SASI_Hs02_00518530 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518531 predicted 602
2 SASI_Hs02_00518532 predicted 623
3 SASI_Hs02_00518533 predicted 609
4 SASI_Hs02_00518534 predicted 605
5 SASI_Hs02_00518535 predicted 562
6 SASI_Hs02_00518536 predicted 596
7 SASI_Hs02_00518537 predicted 600
8 SASI_Hs02_00518538 predicted 594
9 SASI_Hs02_00518539 predicted 597
10 SASI_Hs02_00518540 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00518541 predicted 601
2 SASI_Hs02_00518542 predicted 629
3 SASI_Hs02_00518543 predicted 602
4 SASI_Hs02_00518544 predicted 606
5 SASI_Hs02_00518545 predicted 595
6 SASI_Hs02_00518546 predicted 601
7 SASI_Hs02_00518547 predicted 587
8 SASI_Hs02_00518548 predicted 599
9 SASI_Hs02_00518549 predicted 597
10 SASI_Hs02_00518550 predicted 570
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031839
C8orf49 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 49
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-606s1c1
Sequence:CCGGCGTCACCCTGTAACAACACAACTCGAGTTGTGTTGTTACAGGGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-465s1c1
Sequence:CCGGGCCATTCGGAAAGCTCTTTCTCTCGAGAGAAAGAGCTTTCCGAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-701s1c1
Sequence:CCGGCTTTACACTGTTGCTCCCATTCTCGAGAATGGGAGCAACAGTGTAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031839.1-1237s1c1
Sequence:CCGGGCTGCTGTTATTTGCCTGATACTCGAGTATCAGGCAAATAACAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-647s1c1
Sequence:CCGGGCTTAGCTTGGGAAGTGGAATCTCGAGATTCCACTTCCCAAGCTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031839
C8orf49 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 49
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-606s1c1
Sequence:CCGGCGTCACCCTGTAACAACACAACTCGAGTTGTGTTGTTACAGGGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-465s1c1
Sequence:CCGGGCCATTCGGAAAGCTCTTTCTCTCGAGAGAAAGAGCTTTCCGAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-701s1c1
Sequence:CCGGCTTTACACTGTTGCTCCCATTCTCGAGAATGGGAGCAACAGTGTAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031839.1-1237s1c1
Sequence:CCGGGCTGCTGTTATTTGCCTGATACTCGAGTATCAGGCAAATAACAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-647s1c1
Sequence:CCGGGCTTAGCTTGGGAAGTGGAATCTCGAGATTCCACTTCCCAAGCTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031839
C8orf49 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 49
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181121    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-606s1c1
Sequence:CCGGCGTCACCCTGTAACAACACAACTCGAGTTGTGTTGTTACAGGGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-465s1c1
Sequence:CCGGGCCATTCGGAAAGCTCTTTCTCTCGAGAGAAAGAGCTTTCCGAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-701s1c1
Sequence:CCGGCTTTACACTGTTGCTCCCATTCTCGAGAATGGGAGCAACAGTGTAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179582    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001031839.1-1237s1c1
Sequence:CCGGGCTGCTGTTATTTGCCTGATACTCGAGTATCAGGCAAATAACAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031839.1-647s1c1
Sequence:CCGGGCTTAGCTTGGGAAGTGGAATCTCGAGATTCCACTTCCCAAGCTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)