EMAIL THIS PAGE TO A FRIEND

C8orf4

chromosome 8 open reading frame 4

141 Gene Product Result for
Synonyms: TC-1 TC1
UniProtKB ID: Q9NR00
Gene ID:
Human(56892) Summary: This gene encodes a small, monomeric, predominantly unstructured protein that functions as a positive regulator of the Wnt/beta-catenin signaling pathway. This protein interacts with a repressor of beta-catenin mediated transcription at nuclear speckles. It is thought to competitively block interactions of the repressor with beta-catenin, resulting in up-regulation of beta-catenin target genes. The encoded protein may also play a role in the NF-kappaB and ERK1/2 signaling pathways. Expression of this gene may play a role in the proliferation of several types of cancer including thyroid cancer, breast cancer and hematological malignancies. [provided by RefSeq, Nov 2011]
chicken(771032) chromosome 22 open reading frame, human C8orf4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020130 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020130 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020130 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU047621 MISSION® esiRNA esiRNA human C8orf4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020130 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020130 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113477 predicted 425
2 SASI_Hs01_00113478 predicted 401
3 SASI_Hs01_00113479 predicted 341
4 SASI_Hs01_00113480 predicted 351
5 SASI_Hs01_00113482 predicted 351
6 SASI_Hs01_00113483 predicted 445
7 SASI_Hs01_00113485 predicted 392
8 SASI_Hs01_00113486 predicted 336
9 SASI_Hs02_00353003 predicted 240
10 SASI_Hs02_00353004 predicted 244
11 SASI_Hs01_00113481 predicted 312
12 SASI_Hs01_00113484 predicted 312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020130
VALIDATED
C8orf4 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-151s1c1
Sequence:CCGGGACACAGCCTCTCGTAAGAAACTCGAGTTTCTTACGAGAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-209s1c1
Sequence:CCGGCACTAGAAAGGCTCTTCAGAACTCGAGTTCTGAAGAGCCTTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020130.2-599s1c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020130.2-622s1c1
Sequence:CCGGGCTTTCAGCAAGGATTTGAAACTCGAGTTTCAAATCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-197s1c1
Sequence:CCGGCAGACCAAGAATCACTAGAAACTCGAGTTTCTAGTGATTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-222s1c1
Sequence:CCGGCTTCAGAAACTCTGGAGACAACTCGAGTTGTCTCCAGAGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-236s1c1
Sequence:CCGGGAGACAAGAAAGCAGAGGAGACTCGAGTCTCCTCTGCTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-346s21c1
Sequence:CCGGTTTCTGAAACTGCGGAAATATCTCGAGATATTTCCGCAGTTTCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-167s21c1
Sequence:CCGGCCGTGGGCAACATCTTTGAAACTCGAGTTTCAAAGATGTTGCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-382s21c1
Sequence:CCGGTGAAGAGAAGAGGATGGATAACTCGAGTTATCCATCCTCTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-245s21c1
Sequence:CCGGAGGAGAGAGCCAAGATCATTTCTCGAGAAATGATCTTGGCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-593s21c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020130
VALIDATED
C8orf4 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-151s1c1
Sequence:CCGGGACACAGCCTCTCGTAAGAAACTCGAGTTTCTTACGAGAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-209s1c1
Sequence:CCGGCACTAGAAAGGCTCTTCAGAACTCGAGTTCTGAAGAGCCTTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020130.2-599s1c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020130.2-622s1c1
Sequence:CCGGGCTTTCAGCAAGGATTTGAAACTCGAGTTTCAAATCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-197s1c1
Sequence:CCGGCAGACCAAGAATCACTAGAAACTCGAGTTTCTAGTGATTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-222s1c1
Sequence:CCGGCTTCAGAAACTCTGGAGACAACTCGAGTTGTCTCCAGAGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-236s1c1
Sequence:CCGGGAGACAAGAAAGCAGAGGAGACTCGAGTCTCCTCTGCTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-346s21c1
Sequence:CCGGTTTCTGAAACTGCGGAAATATCTCGAGATATTTCCGCAGTTTCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-167s21c1
Sequence:CCGGCCGTGGGCAACATCTTTGAAACTCGAGTTTCAAAGATGTTGCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-382s21c1
Sequence:CCGGTGAAGAGAAGAGGATGGATAACTCGAGTTATCCATCCTCTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-245s21c1
Sequence:CCGGAGGAGAGAGCCAAGATCATTTCTCGAGAAATGATCTTGGCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-593s21c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020130
VALIDATED
C8orf4 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-151s1c1
Sequence:CCGGGACACAGCCTCTCGTAAGAAACTCGAGTTTCTTACGAGAGGCTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-209s1c1
Sequence:CCGGCACTAGAAAGGCTCTTCAGAACTCGAGTTCTGAAGAGCCTTTCTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136679    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_020130.2-599s1c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134417    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020130.2-622s1c1
Sequence:CCGGGCTTTCAGCAAGGATTTGAAACTCGAGTTTCAAATCCTTGCTGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-197s1c1
Sequence:CCGGCAGACCAAGAATCACTAGAAACTCGAGTTTCTAGTGATTCTTGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020130.2-222s1c1
Sequence:CCGGCTTCAGAAACTCTGGAGACAACTCGAGTTGTCTCCAGAGTTTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020130.2-236s1c1
Sequence:CCGGGAGACAAGAAAGCAGAGGAGACTCGAGTCTCCTCTGCTTTCTTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-346s21c1
Sequence:CCGGTTTCTGAAACTGCGGAAATATCTCGAGATATTTCCGCAGTTTCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-167s21c1
Sequence:CCGGCCGTGGGCAACATCTTTGAAACTCGAGTTTCAAAGATGTTGCCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-382s21c1
Sequence:CCGGTGAAGAGAAGAGGATGGATAACTCGAGTTATCCATCCTCTTCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020130.3-245s21c1
Sequence:CCGGAGGAGAGAGCCAAGATCATTTCTCGAGAAATGATCTTGGCTCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274946    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_020130.3-593s21c1
Sequence:CCGGGCTGTTACAGAGGAGAACAAACTCGAGTTTGTTCTCCTCTGTAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks