EMAIL THIS PAGE TO A FRIEND

C8orf58

chromosome 8 open reading frame 58

Species: Human C8orf58(541565)
UniProtKB ID: Q8NAV2, B4DI44
Gene ID:
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013842 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003411 MISSION® esiRNA esiRNA targeting human C8orf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013842 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180096 predicted 1341
2 SASI_Hs01_00180097 predicted 1337
3 SASI_Hs01_00180098 predicted 986
4 SASI_Hs01_00180099 predicted 836
5 SASI_Hs01_00180100 predicted 1533
6 SASI_Hs02_00306500 predicted 1538
7 SASI_Hs01_00180101 predicted 595
8 SASI_Hs02_00306501 predicted 1514
9 SASI_Hs01_00180102 predicted 1618
10 SASI_Hs01_00180103 predicted 1563
11 SASI_Hs01_00180095 predicted 990
12 SASI_Hs01_00180104 predicted 1472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013842
C8orf58 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 58
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000173090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-288s1c1
Sequence:CCGGCACTCTTTCTCAAACTGGCCTCTCGAGAGGCCAGTTTGAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1145s1c1
Sequence:CCGGCGGAAGACCTTTATGCCATCACTCGAGTGATGGCATAAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-386s1c1
Sequence:CCGGGACTTTGAATCCTCAGGGAGTCTCGAGACTCCCTGAGGATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1153s1c1
Sequence:CCGGCTTTATGCCATCATTAGTGGTCTCGAGACCACTAATGATGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013842
C8orf58 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 58
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000173090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-288s1c1
Sequence:CCGGCACTCTTTCTCAAACTGGCCTCTCGAGAGGCCAGTTTGAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1145s1c1
Sequence:CCGGCGGAAGACCTTTATGCCATCACTCGAGTGATGGCATAAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-386s1c1
Sequence:CCGGGACTTTGAATCCTCAGGGAGTCTCGAGACTCCCTGAGGATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1153s1c1
Sequence:CCGGCTTTATGCCATCATTAGTGGTCTCGAGACCACTAATGATGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013842
C8orf58 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 58
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000173090    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-288s1c1
Sequence:CCGGCACTCTTTCTCAAACTGGCCTCTCGAGAGGCCAGTTTGAGAAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1145s1c1
Sequence:CCGGCGGAAGACCTTTATGCCATCACTCGAGTGATGGCATAAAGGTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-386s1c1
Sequence:CCGGGACTTTGAATCCTCAGGGAGTCTCGAGACTCCCTGAGGATTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013842.1-1153s1c1
Sequence:CCGGCTTTATGCCATCATTAGTGGTCTCGAGACCACTAATGATGGCATAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks