EMAIL THIS PAGE TO A FRIEND

C8orf59

chromosome 8 open reading frame 59

118 Gene Product Result for
Species: Human C8orf59(401466)
UniProtKB ID: Q8N0T1, B2RXE7, E5RFW5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099670 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228611 MISSION® esiRNA esiRNA targeting human C8orf59 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099670 Rosetta Predictions human pricing
NM_001099671 Rosetta Predictions human pricing
NM_001099672 Rosetta Predictions human pricing
NM_001099673 Rosetta Predictions human pricing
XM_376783 Rosetta Predictions human pricing
XM_929832 Rosetta Predictions human pricing
XM_933998 Rosetta Predictions human pricing
XM_934001 Rosetta Predictions human pricing
XM_934005 Rosetta Predictions human pricing
XM_934008 Rosetta Predictions human pricing
XM_934011 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320968 predicted 480
2 SASI_Hs02_00320969 predicted 822
3 SASI_Hs02_00320970 predicted 533
4 SASI_Hs02_00320971 predicted 550
5 SASI_Hs02_00320972 predicted 651
6 SASI_Hs02_00320973 predicted 804
7 SASI_Hs02_00320974 predicted 682
8 SASI_Hs02_00320975 predicted 714
9 SASI_Hs02_00320976 predicted 436
10 SASI_Hs02_00320977 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320978 predicted 481
2 SASI_Hs02_00320979 predicted 826
3 SASI_Hs02_00320980 predicted 527
4 SASI_Hs02_00320981 predicted 546
5 SASI_Hs02_00320982 predicted 655
6 SASI_Hs02_00320983 predicted 808
7 SASI_Hs02_00320984 predicted 670
8 SASI_Hs02_00320985 predicted 712
9 SASI_Hs02_00320986 predicted 435
10 SASI_Hs02_00320987 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320988 predicted 391
2 SASI_Hs02_00320989 predicted 735
3 SASI_Hs02_00320990 predicted 444
4 SASI_Hs02_00320991 predicted 462
5 SASI_Hs02_00320992 predicted 564
6 SASI_Hs02_00320993 predicted 722
7 SASI_Hs02_00320994 predicted 587
8 SASI_Hs02_00320995 predicted 619
9 SASI_Hs02_00320996 predicted 345
10 SASI_Hs02_00320997 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320998 predicted 347
2 SASI_Hs02_00320999 predicted 692
3 SASI_Hs02_00321000 predicted 406
4 SASI_Hs02_00321001 predicted 426
5 SASI_Hs02_00321002 predicted 530
6 SASI_Hs02_00321003 predicted 682
7 SASI_Hs02_00321004 predicted 548
8 SASI_Hs02_00321005 predicted 582
9 SASI_Hs02_00321006 predicted 304
10 SASI_Hs02_00321007 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00297212 predicted 419
2 SASI_Hs01_00297213 predicted 755
3 SASI_Hs01_00297214 predicted 349
4 SASI_Hs01_00297215 predicted 258
5 SASI_Hs01_00297216 predicted 482
6 SASI_Hs01_00297217 predicted 734
7 SASI_Hs01_00297218 predicted 450
8 SASI_Hs01_00297219 predicted 499
9 SASI_Hs01_00297220 predicted 610
10 SASI_Hs01_00297221 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929832 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248802 predicted 133
2 SASI_Hs01_00248803 predicted 141
3 SASI_Hs01_00248804 predicted 203
4 SASI_Hs01_00248805 predicted 210
5 SASI_Hs01_00248806 predicted 135
6 SASI_Hs01_00248807 predicted 134
7 SASI_Hs01_00248808 predicted 150
8 SASI_Hs01_00248809 predicted 149
9 SASI_Hs01_00248810 predicted 219
10 SASI_Hs01_00248811 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00290874 predicted 3082
2 SASI_Hs01_00290875 predicted 3421
3 SASI_Hs01_00290876 predicted 3012
4 SASI_Hs01_00290877 predicted 2921
5 SASI_Hs01_00290878 predicted 3140
6 SASI_Hs01_00290879 predicted 3397
7 SASI_Hs01_00290880 predicted 3115
8 SASI_Hs01_00290881 predicted 3161
9 SASI_Hs01_00290882 predicted 3266
10 SASI_Hs01_00290883 predicted 3301
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257237 predicted 2153
2 SASI_Hs01_00257238 predicted 2489
3 SASI_Hs01_00257239 predicted 2090
4 SASI_Hs01_00257240 predicted 1999
5 SASI_Hs01_00257241 predicted 2224
6 SASI_Hs01_00257242 predicted 2474
7 SASI_Hs01_00257243 predicted 2182
8 SASI_Hs01_00257244 predicted 2239
9 SASI_Hs01_00257245 predicted 2351
10 SASI_Hs01_00257246 predicted 2383
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264654 predicted 540
2 SASI_Hs01_00264655 predicted 749
3 SASI_Hs01_00264656 predicted 208
4 SASI_Hs01_00264657 predicted 316
5 SASI_Hs01_00264658 predicted 344
6 SASI_Hs01_00264659 predicted 439
7 SASI_Hs01_00264660 predicted 231
8 SASI_Hs01_00264661 predicted 552
9 SASI_Hs01_00264662 predicted 350
10 SASI_Hs01_00264663 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934008 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00295235 predicted 354
2 SASI_Hs01_00295236 predicted 694
3 SASI_Hs01_00295237 predicted 285
4 SASI_Hs01_00295238 predicted 207
5 SASI_Hs01_00295239 predicted 422
6 SASI_Hs01_00295240 predicted 675
7 SASI_Hs01_00295241 predicted 395
8 SASI_Hs01_00295242 predicted 443
9 SASI_Hs01_00295243 predicted 554
10 SASI_Hs01_00295244 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934011 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279528 predicted 353
2 SASI_Hs01_00279529 predicted 702
3 SASI_Hs01_00279530 predicted 286
4 SASI_Hs01_00279531 predicted 200
5 SASI_Hs01_00279532 predicted 428
6 SASI_Hs01_00279533 predicted 677
7 SASI_Hs01_00279534 predicted 394
8 SASI_Hs01_00279535 predicted 433
9 SASI_Hs01_00279536 predicted 545
10 SASI_Hs01_00279537 predicted 585
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099670
VALIDATED
C8orf59 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 59
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-544s21c1
Sequence:CCGGTATACTGGTGATGCATCTAATCTCGAGATTAGATGCATCACCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-487s21c1
Sequence:CCGGCATGAAAGCAAACCAGTTAATCTCGAGATTAACTGGTTTGCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-330s21c1
Sequence:CCGGACCAGTTACCACTAATCTTAACTCGAGTTAAGATTAGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-266s21c1
Sequence:CCGGCGAAGTCCAGGAATGTATTTCCTCGAGGAAATACATTCCTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-510s21c1
Sequence:CCGGTGATGAAGCTACAAGATTAATCTCGAGATTAATCTTGTAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099670
VALIDATED
C8orf59 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 59
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-544s21c1
Sequence:CCGGTATACTGGTGATGCATCTAATCTCGAGATTAGATGCATCACCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-487s21c1
Sequence:CCGGCATGAAAGCAAACCAGTTAATCTCGAGATTAACTGGTTTGCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-330s21c1
Sequence:CCGGACCAGTTACCACTAATCTTAACTCGAGTTAAGATTAGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-266s21c1
Sequence:CCGGCGAAGTCCAGGAATGTATTTCCTCGAGGAAATACATTCCTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-510s21c1
Sequence:CCGGTGATGAAGCTACAAGATTAATCTCGAGATTAATCTTGTAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099670
VALIDATED
C8orf59 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 59
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282894    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-544s21c1
Sequence:CCGGTATACTGGTGATGCATCTAATCTCGAGATTAGATGCATCACCAGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-487s21c1
Sequence:CCGGCATGAAAGCAAACCAGTTAATCTCGAGATTAACTGGTTTGCTTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-330s21c1
Sequence:CCGGACCAGTTACCACTAATCTTAACTCGAGTTAAGATTAGTGGTAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-266s21c1
Sequence:CCGGCGAAGTCCAGGAATGTATTTCCTCGAGGAAATACATTCCTGGACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099670.1-510s21c1
Sequence:CCGGTGATGAAGCTACAAGATTAATCTCGAGATTAATCTTGTAGCTTCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks