EMAIL THIS PAGE TO A FRIEND

C8orf74

chromosome 8 open reading frame 74

18 Gene Product Result for
Species: Human C8orf74(203076)
UniProtKB ID: Q6P047, A2RUD6
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001040032 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001040032 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001040032 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145341 MISSION® esiRNA esiRNA human C8orf74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040032 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148102 predicted 251
2 SASI_Hs01_00148103 predicted 381
3 SASI_Hs01_00148105 predicted 239
4 SASI_Hs01_00148106 predicted 736
5 SASI_Hs01_00148107 predicted 274
6 SASI_Hs01_00148109 predicted 358
7 SASI_Hs02_00308765 predicted 385
8 SASI_Hs01_00148110 predicted 495
9 SASI_Hs01_00148111 predicted 370
10 SASI_Hs02_00308766 predicted 226
11 SASI_Hs01_00148104 predicted 707
12 SASI_Hs01_00148108 predicted 362
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001040032
C8orf74 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 74
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000264225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-752s21c1
Sequence:CCGGCCAGAACACATTCGCCATCTTCTCGAGAAGATGGCGAATGTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-896s21c1
Sequence:CCGGAGCGAAGGCAAGGAAGTAGAACTCGAGTTCTACTTCCTTGCCTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-379s21c1
Sequence:CCGGCCTTCATCCGCCACTACAAACCTCGAGGTTTGTAGTGGCGGATGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-172s21c1
Sequence:CCGGTCTACGAGAGCATCATCTTTGCTCGAGCAAAGATGATGCTCTCGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001040032
C8orf74 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 74
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000264225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-752s21c1
Sequence:CCGGCCAGAACACATTCGCCATCTTCTCGAGAAGATGGCGAATGTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-896s21c1
Sequence:CCGGAGCGAAGGCAAGGAAGTAGAACTCGAGTTCTACTTCCTTGCCTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-379s21c1
Sequence:CCGGCCTTCATCCGCCACTACAAACCTCGAGGTTTGTAGTGGCGGATGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-172s21c1
Sequence:CCGGTCTACGAGAGCATCATCTTTGCTCGAGCAAAGATGATGCTCTCGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001040032
C8orf74 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 74
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000264225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-752s21c1
Sequence:CCGGCCAGAACACATTCGCCATCTTCTCGAGAAGATGGCGAATGTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-896s21c1
Sequence:CCGGAGCGAAGGCAAGGAAGTAGAACTCGAGTTCTACTTCCTTGCCTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-379s21c1
Sequence:CCGGCCTTCATCCGCCACTACAAACCTCGAGGTTTGTAGTGGCGGATGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001040032.1-172s21c1
Sequence:CCGGTCTACGAGAGCATCATCTTTGCTCGAGCAAAGATGATGCTCTCGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)