EMAIL THIS PAGE TO A FRIEND

C8orf76

chromosome 8 open reading frame 76

44 Gene Product Result for
Species: Human C8orf76(84933)
UniProtKB ID: Q96K31, Q53HC1
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032847 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU067891 MISSION® esiRNA esiRNA human C8orf76 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032847 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032847 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149524 predicted 421
2 SASI_Hs02_00360442 predicted 969
3 SASI_Hs01_00149526 predicted 407
4 SASI_Hs01_00149527 predicted 901
5 SASI_Hs01_00149528 predicted 220
6 SASI_Hs01_00149529 predicted 217
7 SASI_Hs02_00360443 predicted 255
8 SASI_Hs01_00149531 predicted 1053
9 SASI_Hs01_00149532 predicted 584
10 SASI_Hs01_00149533 predicted 599
11 SASI_Hs01_00149525 predicted 955
12 SASI_Hs01_00149530 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032847
VALIDATED
C8orf76 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 76
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-399s21c1
Sequence:CCGGCAACCAACACAGACCATTTAACTCGAGTTAAATGGTCTGTGTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-686s21c1
Sequence:CCGGACCTTGCCTGAGAGCTCTTTACTCGAGTAAAGAGCTCTCAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-744s21c1
Sequence:CCGGATGAGAAAGCTCTGACAAATACTCGAGTATTTGTCAGAGCTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-430s21c1
Sequence:CCGGCTACCTCCAGCTTGCTATTTGCTCGAGCAAATAGCAAGCTGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-713s21c1
Sequence:CCGGGTGGAAGCGAATAGCAGTAATCTCGAGATTACTGCTATTCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-953s1c1
Sequence:CCGGGAAGACACTTTGCTGTTGATACTCGAGTATCAACAGCAAAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-1096s1c1
Sequence:CCGGCAAGTGGTTCAGAAAGATCAACTCGAGTTGATCTTTCTGAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-487s1c1
Sequence:CCGGCCTGCAGAAACTGATTTCTTTCTCGAGAAAGAAATCAGTTTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032847
VALIDATED
C8orf76 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 76
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-399s21c1
Sequence:CCGGCAACCAACACAGACCATTTAACTCGAGTTAAATGGTCTGTGTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-686s21c1
Sequence:CCGGACCTTGCCTGAGAGCTCTTTACTCGAGTAAAGAGCTCTCAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-744s21c1
Sequence:CCGGATGAGAAAGCTCTGACAAATACTCGAGTATTTGTCAGAGCTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-430s21c1
Sequence:CCGGCTACCTCCAGCTTGCTATTTGCTCGAGCAAATAGCAAGCTGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-713s21c1
Sequence:CCGGGTGGAAGCGAATAGCAGTAATCTCGAGATTACTGCTATTCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-953s1c1
Sequence:CCGGGAAGACACTTTGCTGTTGATACTCGAGTATCAACAGCAAAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-1096s1c1
Sequence:CCGGCAAGTGGTTCAGAAAGATCAACTCGAGTTGATCTTTCTGAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-487s1c1
Sequence:CCGGCCTGCAGAAACTGATTTCTTTCTCGAGAAAGAAATCAGTTTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032847
VALIDATED
C8orf76 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 76
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-399s21c1
Sequence:CCGGCAACCAACACAGACCATTTAACTCGAGTTAAATGGTCTGTGTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-686s21c1
Sequence:CCGGACCTTGCCTGAGAGCTCTTTACTCGAGTAAAGAGCTCTCAGGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-744s21c1
Sequence:CCGGATGAGAAAGCTCTGACAAATACTCGAGTATTTGTCAGAGCTTTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-430s21c1
Sequence:CCGGCTACCTCCAGCTTGCTATTTGCTCGAGCAAATAGCAAGCTGGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032847.1-713s21c1
Sequence:CCGGGTGGAAGCGAATAGCAGTAATCTCGAGATTACTGCTATTCGCTTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-953s1c1
Sequence:CCGGGAAGACACTTTGCTGTTGATACTCGAGTATCAACAGCAAAGTGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-1096s1c1
Sequence:CCGGCAAGTGGTTCAGAAAGATCAACTCGAGTTGATCTTTCTGAACCACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146794    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032847.1-487s1c1
Sequence:CCGGCCTGCAGAAACTGATTTCTTTCTCGAGAAAGAAATCAGTTTCTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks