EMAIL THIS PAGE TO A FRIEND

C8orf82

chromosome 8 open reading frame 82

35 Gene Product Result for
Species: Human C8orf82(414919)
UniProtKB ID: Q6P1X6, Q6GMR2, Q6P2Q7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001795 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU225251 MISSION® esiRNA esiRNA targeting human C8orf82 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001795 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168591 predicted 360
2 SASI_Hs01_00168592 predicted 272
3 SASI_Hs01_00168593 predicted 1256
4 SASI_Hs02_00303946 predicted 332
5 SASI_Hs02_00303947 predicted 1575
6 SASI_Hs02_00303948 predicted 1576
7 SASI_Hs02_00303949 predicted 1526
8 SASI_Hs02_00303950 predicted 1574
9 SASI_Hs02_00303951 predicted 1528
10 SASI_Hs02_00303952 predicted 1773
11 SASI_Hs01_00168590 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001795
VALIDATED
C8orf82 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 82
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1781s1c1
Sequence:CCGGGCCACGTACCAACACTTTATACTCGAGTATAAAGTGTTGGTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-341s1c1
Sequence:CCGGGAATTTCATCACCTGCTTCAACTCGAGTTGAAGCAGGTGATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1779s1c1
Sequence:CCGGGAGCCACGTACCAACACTTTACTCGAGTAAAGTGTTGGTACGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-281s1c1
Sequence:CCGGCGAGTATTTCTACTACGTGGACTCGAGTCCACGTAGTAGAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1721s1c1
Sequence:CCGGCCAAGAACCTTCTCCACTTGACTCGAGTCAAGTGGAGAAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1729s1c1
Sequence:CCGGCTTCTCCACTTGAGAAGCCTTCTCGAGAAGGCTTCTCAAGTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001795
VALIDATED
C8orf82 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 82
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1781s1c1
Sequence:CCGGGCCACGTACCAACACTTTATACTCGAGTATAAAGTGTTGGTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-341s1c1
Sequence:CCGGGAATTTCATCACCTGCTTCAACTCGAGTTGAAGCAGGTGATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1779s1c1
Sequence:CCGGGAGCCACGTACCAACACTTTACTCGAGTAAAGTGTTGGTACGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-281s1c1
Sequence:CCGGCGAGTATTTCTACTACGTGGACTCGAGTCCACGTAGTAGAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1721s1c1
Sequence:CCGGCCAAGAACCTTCTCCACTTGACTCGAGTCAAGTGGAGAAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1729s1c1
Sequence:CCGGCTTCTCCACTTGAGAAGCCTTCTCGAGAAGGCTTCTCAAGTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001795
VALIDATED
C8orf82 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 82
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1781s1c1
Sequence:CCGGGCCACGTACCAACACTTTATACTCGAGTATAAAGTGTTGGTACGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-341s1c1
Sequence:CCGGGAATTTCATCACCTGCTTCAACTCGAGTTGAAGCAGGTGATGAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172567    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001001795.1-1779s1c1
Sequence:CCGGGAGCCACGTACCAACACTTTACTCGAGTAAAGTGTTGGTACGTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001001795.1-281s1c1
Sequence:CCGGCGAGTATTTCTACTACGTGGACTCGAGTCCACGTAGTAGAAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172400    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1721s1c1
Sequence:CCGGCCAAGAACCTTCTCCACTTGACTCGAGTCAAGTGGAGAAGGTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001001795.1-1729s1c1
Sequence:CCGGCTTCTCCACTTGAGAAGCCTTCTCGAGAAGGCTTCTCAAGTGGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks