EMAIL THIS PAGE TO A FRIEND

C8orf86

chromosome 8 open reading frame 86

51 Gene Product Result for
Species: Human C8orf86(389649)
UniProtKB ID: Q6ZUL3, A4QPB7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052201 MISSION® esiRNA esiRNA human AC087623.21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207412 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188691 predicted 1003
2 SASI_Hs01_00188692 predicted 964
3 SASI_Hs01_00188693 predicted 936
4 SASI_Hs01_00188694 predicted 938
5 SASI_Hs01_00188696 predicted 938
6 SASI_Hs01_00188697 predicted 1012
7 SASI_Hs02_00374044 predicted 841
8 SASI_Hs01_00188699 predicted 757
9 SASI_Hs01_00188700 predicted 1115
10 SASI_Hs02_00374045 predicted 1077
11 SASI_Hs01_00188695 predicted 975
12 SASI_Hs01_00188698 predicted 928
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207412
C8orf86 MISSION shRNA Bacterial Glycerol Stock
chromosome 8 open reading frame 86
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-225s1c1
Sequence:CCGGGCAGTTCCAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-944s1c1
Sequence:CCGGCGCAGTAACACACGTAGGTTTCTCGAGAAACCTACGTGTGTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-467s1c1
Sequence:CCGGGACTCCTTTCTTGTCCTGGAACTCGAGTTCCAGGACAAGAAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-410s1c1
Sequence:CCGGGTGATCTCTCATTCTTCCATTCTCGAGAATGGAAGAATGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-575s1c1
Sequence:CCGGGAACTGATTGGAAATGCACATCTCGAGATGTGCATTTCCAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-609s1c1
Sequence:CCGGCCAGAACTCCTGAATTAGAAACTCGAGTTTCTAATTCAGGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-59s1c1
Sequence:CCGGGAGGAGTTGATTAGAAGCAATCTCGAGATTGCTTCTAATCAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-1912s1c1
Sequence:CCGGGCCTCTGAAGAAATAATGCAACTCGAGTTGCATTATTTCTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-369s1c1
Sequence:CCGGGACTCGCATCTGTGGTTTCTTCTCGAGAAGAAACCACAGATGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-166s1c1
Sequence:CCGGCAAGTTTGGGACAGAAGGGAACTCGAGTTCCCTTCTGTCCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207412
C8orf86 MISSION shRNA shRNA Plasmid DNA
chromosome 8 open reading frame 86
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-225s1c1
Sequence:CCGGGCAGTTCCAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-944s1c1
Sequence:CCGGCGCAGTAACACACGTAGGTTTCTCGAGAAACCTACGTGTGTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-467s1c1
Sequence:CCGGGACTCCTTTCTTGTCCTGGAACTCGAGTTCCAGGACAAGAAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-410s1c1
Sequence:CCGGGTGATCTCTCATTCTTCCATTCTCGAGAATGGAAGAATGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-575s1c1
Sequence:CCGGGAACTGATTGGAAATGCACATCTCGAGATGTGCATTTCCAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-609s1c1
Sequence:CCGGCCAGAACTCCTGAATTAGAAACTCGAGTTTCTAATTCAGGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-59s1c1
Sequence:CCGGGAGGAGTTGATTAGAAGCAATCTCGAGATTGCTTCTAATCAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-1912s1c1
Sequence:CCGGGCCTCTGAAGAAATAATGCAACTCGAGTTGCATTATTTCTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-369s1c1
Sequence:CCGGGACTCGCATCTGTGGTTTCTTCTCGAGAAGAAACCACAGATGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-166s1c1
Sequence:CCGGCAAGTTTGGGACAGAAGGGAACTCGAGTTCCCTTCTGTCCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207412
C8orf86 MISSION shRNA Lentiviral Transduction Particles
chromosome 8 open reading frame 86
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-225s1c1
Sequence:CCGGGCAGTTCCAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138332    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-944s1c1
Sequence:CCGGCGCAGTAACACACGTAGGTTTCTCGAGAAACCTACGTGTGTTACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-467s1c1
Sequence:CCGGGACTCCTTTCTTGTCCTGGAACTCGAGTTCCAGGACAAGAAAGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-410s1c1
Sequence:CCGGGTGATCTCTCATTCTTCCATTCTCGAGAATGGAAGAATGAGAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-575s1c1
Sequence:CCGGGAACTGATTGGAAATGCACATCTCGAGATGTGCATTTCCAATCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-609s1c1
Sequence:CCGGCCAGAACTCCTGAATTAGAAACTCGAGTTTCTAATTCAGGAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134303    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-59s1c1
Sequence:CCGGGAGGAGTTGATTAGAAGCAATCTCGAGATTGCTTCTAATCAACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134672    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207412.1-1912s1c1
Sequence:CCGGGCCTCTGAAGAAATAATGCAACTCGAGTTGCATTATTTCTTCAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207412.1-369s1c1
Sequence:CCGGGACTCGCATCTGTGGTTTCTTCTCGAGAAGAAACCACAGATGCGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138235    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207412.1-166s1c1
Sequence:CCGGCAAGTTTGGGACAGAAGGGAACTCGAGTTCCCTTCTGTCCCAAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks