EMAIL THIS PAGE TO A FRIEND

C9

complement component 9

73 Gene Product Result for
UniProtKB ID: P02748
Gene ID:
Human(735) Summary: This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Mouse(12279) complement component 9
Rat(117512) complement component 9
naked mole-rat(101726632) complement component 9
domestic guinea pig(100715319) complement component 9
sheep(101105026) complement component 9
Domestic Rabbit(100009197) complement component 9
Zebrafish(554141) complement component 9
cow(280680) complement component 9
cow(526766) complement component 9
Horse(100034183) complement component 9
domestic cat(101096948) complement component 9
dog(479354) complement component 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0489 AQUA Peptide LSPIYNLVPV[K] human pricing
AQ0490 AQUA Peptide VVEESELA[R] human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001737 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU029501 MISSION® esiRNA esiRNA human C9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001737 Rosetta Predictions human pricing
NM_057146 Rosetta Predictions rat pricing
NM_013485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107450 predicted 1582
2 SASI_Hs01_00107451 predicted 1364
3 SASI_Hs01_00107452 predicted 434
4 SASI_Hs01_00107453 predicted 1348
5 SASI_Hs01_00107454 predicted 1264
6 SASI_Hs01_00107455 predicted 385
7 SASI_Hs01_00107456 predicted 666
8 SASI_Hs01_00107457 predicted 1021
9 SASI_Hs02_00332451 predicted 1318
10 SASI_Hs02_00332452 predicted 1676
11 SASI_Hs01_00107458 predicted 1594
12 SASI_Hs01_00107459 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120759 predicted 362
2 SASI_Rn01_00120760 predicted 841
3 SASI_Rn01_00120761 predicted 386
4 SASI_Rn01_00120762 predicted 896
5 SASI_Rn01_00120763 predicted 1197
6 SASI_Rn01_00120764 predicted 689
7 SASI_Rn01_00120765 predicted 377
8 SASI_Rn01_00120766 predicted 599
9 SASI_Rn02_00267104 predicted 644
10 SASI_Rn01_00120767 predicted 997
11 SASI_Rn01_00120768 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145136 predicted 993
2 SASI_Mm01_00145137 predicted 1030
3 SASI_Mm01_00145138 predicted 695
4 SASI_Mm01_00145139 predicted 1115
5 SASI_Mm01_00145140 predicted 1329
6 SASI_Mm02_00322125 predicted 1221
7 SASI_Mm01_00145141 predicted 1248
8 SASI_Mm01_00145142 predicted 518
9 SASI_Mm01_00145143 predicted 390
10 SASI_Mm01_00145144 predicted 1410
11 SASI_Mm01_00145145 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001737
C9 MISSION shRNA Bacterial Glycerol Stock
complement component 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001737.2-1902s1c1
Sequence:CCGGCTTCTCTCTTAGGTCTATAATCTCGAGATTATAGACCTAAGAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-730s1c1
Sequence:CCGGCCGAACATTACGAAGAACAAACTCGAGTTTGTTCTTCGTAATGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-1701s1c1
Sequence:CCGGGCCTGTGAAATCAGTAAACAACTCGAGTTGTTTACTGATTTCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-163s1c1
Sequence:CCGGCCAGTTATGACCCAGAGCTAACTCGAGTTAGCTCTGGGTCATAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-555s1c1
Sequence:CCGGGCAGGCTATGGGATCAACATTCTCGAGAATGTTGATCCCATAGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-1193s21c1
Sequence:CCGGGCGGAAAGGTGTTGAACTAAACTCGAGTTTAGTTCAACACCTTTCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-430s21c1
Sequence:CCGGAGATGCGACTTCGGTGTAATGCTCGAGCATTACACCGAAGTCGCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001737.3-2152s21c1
Sequence:CCGGCGTCTGTACCATGCAATTTAACTCGAGTTAAATTGCATGGTACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001737
C9 MISSION shRNA shRNA Plasmid DNA
complement component 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001737.2-1902s1c1
Sequence:CCGGCTTCTCTCTTAGGTCTATAATCTCGAGATTATAGACCTAAGAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-730s1c1
Sequence:CCGGCCGAACATTACGAAGAACAAACTCGAGTTTGTTCTTCGTAATGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-1701s1c1
Sequence:CCGGGCCTGTGAAATCAGTAAACAACTCGAGTTGTTTACTGATTTCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-163s1c1
Sequence:CCGGCCAGTTATGACCCAGAGCTAACTCGAGTTAGCTCTGGGTCATAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-555s1c1
Sequence:CCGGGCAGGCTATGGGATCAACATTCTCGAGAATGTTGATCCCATAGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-1193s21c1
Sequence:CCGGGCGGAAAGGTGTTGAACTAAACTCGAGTTTAGTTCAACACCTTTCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-430s21c1
Sequence:CCGGAGATGCGACTTCGGTGTAATGCTCGAGCATTACACCGAAGTCGCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001737.3-2152s21c1
Sequence:CCGGCGTCTGTACCATGCAATTTAACTCGAGTTAAATTGCATGGTACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001737
C9 MISSION shRNA Lentiviral Transduction Particles
complement component 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057188    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001737.2-1902s1c1
Sequence:CCGGCTTCTCTCTTAGGTCTATAATCTCGAGATTATAGACCTAAGAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-730s1c1
Sequence:CCGGCCGAACATTACGAAGAACAAACTCGAGTTTGTTCTTCGTAATGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-1701s1c1
Sequence:CCGGGCCTGTGAAATCAGTAAACAACTCGAGTTGTTTACTGATTTCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-163s1c1
Sequence:CCGGCCAGTTATGACCCAGAGCTAACTCGAGTTAGCTCTGGGTCATAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001737.2-555s1c1
Sequence:CCGGGCAGGCTATGGGATCAACATTCTCGAGAATGTTGATCCCATAGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-1193s21c1
Sequence:CCGGGCGGAAAGGTGTTGAACTAAACTCGAGTTTAGTTCAACACCTTTCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001737.3-430s21c1
Sequence:CCGGAGATGCGACTTCGGTGTAATGCTCGAGCATTACACCGAAGTCGCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001737.3-2152s21c1
Sequence:CCGGCGTCTGTACCATGCAATTTAACTCGAGTTAAATTGCATGGTACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013485
C9 MISSION shRNA Bacterial Glycerol Stock
complement component 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-740s1c1
Sequence:CCGGCCGAGAGAAGACCTCGAATTTCTCGAGAAATTCGAGGTCTTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-228s1c1
Sequence:CCGGCCTTGCCTCAAACAAAGGTTTCTCGAGAAACCTTTGTTTGAGGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-1377s1c1
Sequence:CCGGGAGCAAGCAATTCTCCTGAAACTCGAGTTTCAGGAGAATTGCTTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-175s1c1
Sequence:CCGGCCATACCGATAGACTGCAGAACTCGAGTTCTGCAGTCTATCGGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-849s1c1
Sequence:CCGGCCTACAAACATTTCAGCTAAACTCGAGTTTAGCTGAAATGTTTGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013485
C9 MISSION shRNA shRNA Plasmid DNA
complement component 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-740s1c1
Sequence:CCGGCCGAGAGAAGACCTCGAATTTCTCGAGAAATTCGAGGTCTTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-228s1c1
Sequence:CCGGCCTTGCCTCAAACAAAGGTTTCTCGAGAAACCTTTGTTTGAGGCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-1377s1c1
Sequence:CCGGGAGCAAGCAATTCTCCTGAAACTCGAGTTTCAGGAGAATTGCTTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-175s1c1
Sequence:CCGGCCATACCGATAGACTGCAGAACTCGAGTTCTGCAGTCTATCGGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-849s1c1
Sequence:CCGGCCTACAAACATTTCAGCTAAACTCGAGTTTAGCTGAAATGTTTGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013485
C9 MISSION shRNA Lentiviral Transduction Particles
complement component 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-740s1c1
Sequence:CCGGCCGAGAGAAGACCTCGAATTTCTCGAGAAATTCGAGGTCTTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-228s1c1
Sequence:CCGGCCTTGCCTCAAACAAAGGTTTCTCGAGAAACCTTTGTTTGAGGCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-1377s1c1
Sequence:CCGGGAGCAAGCAATTCTCCTGAAACTCGAGTTTCAGGAGAATTGCTTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-175s1c1
Sequence:CCGGCCATACCGATAGACTGCAGAACTCGAGTTCTGCAGTCTATCGGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013485.1-849s1c1
Sequence:CCGGCCTACAAACATTTCAGCTAAACTCGAGTTTAGCTGAAATGTTTGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)