EMAIL THIS PAGE TO A FRIEND

C9orf106

chromosome 9 open reading frame 106

43 Gene Product Result for
Synonyms: bA65J3.5
Species: Human C9orf106(414318)
UniProtKB ID: Q8NAJ2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012715 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023521 MISSION® esiRNA esiRNA human C9orf106 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012715 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186600 predicted 580
2 SASI_Hs01_00186599 predicted 582
3 SASI_Hs01_00186598 predicted 585
4 SASI_Hs01_00186601 predicted 588
5 SASI_Hs02_00306218 predicted 597
6 SASI_Hs02_00306219 predicted 599
7 SASI_Hs02_00306220 predicted 587
8 SASI_Hs01_00186603 predicted 590
9 SASI_Hs02_00306221 predicted 606
10 SASI_Hs01_00186604 predicted 54
11 SASI_Hs01_00186597 predicted 610
12 SASI_Hs01_00186602 predicted 615
13 SASI_Hs01_00186605 predicted 1142
14 SASI_Hs01_00186606 predicted 61
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012715
C9orf106 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 106
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-672s1c1
Sequence:CCGGCCTAAGAAAGTTCCCAGTTCTCTCGAGAGAACTGGGAACTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-2472s1c1
Sequence:CCGGGCAATCAATCTCTCTCCTCAACTCGAGTTGAGGAGAGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-397s1c1
Sequence:CCGGCAGGAAGTGAGACATCTGAATCTCGAGATTCAGATGTCTCACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-407s1c1
Sequence:CCGGGACATCTGAATCCTCTGCTCTCTCGAGAGAGCAGAGGATTCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-669s1c1
Sequence:CCGGCCTCCTAAGAAAGTTCCCAGTCTCGAGACTGGGAACTTTCTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-1104s1c1
Sequence:CCGGCCCACCTCTCTGATAAGGATACTCGAGTATCCTTATCAGAGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-591s1c1
Sequence:CCGGCCCTTTGTGTGTCCCATGTAACTCGAGTTACATGGGACACACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-405s1c1
Sequence:CCGGGAGACATCTGAATCCTCTGCTCTCGAGAGCAGAGGATTCAGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-400s1c1
Sequence:CCGGGAAGTGAGACATCTGAATCCTCTCGAGAGGATTCAGATGTCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-203s1c1
Sequence:CCGGCCCTTCCCTTCAGTGCCTCTTCTCGAGAAGAGGCACTGAAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012715
C9orf106 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 106
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-672s1c1
Sequence:CCGGCCTAAGAAAGTTCCCAGTTCTCTCGAGAGAACTGGGAACTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-2472s1c1
Sequence:CCGGGCAATCAATCTCTCTCCTCAACTCGAGTTGAGGAGAGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-397s1c1
Sequence:CCGGCAGGAAGTGAGACATCTGAATCTCGAGATTCAGATGTCTCACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-407s1c1
Sequence:CCGGGACATCTGAATCCTCTGCTCTCTCGAGAGAGCAGAGGATTCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-669s1c1
Sequence:CCGGCCTCCTAAGAAAGTTCCCAGTCTCGAGACTGGGAACTTTCTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-1104s1c1
Sequence:CCGGCCCACCTCTCTGATAAGGATACTCGAGTATCCTTATCAGAGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-591s1c1
Sequence:CCGGCCCTTTGTGTGTCCCATGTAACTCGAGTTACATGGGACACACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-405s1c1
Sequence:CCGGGAGACATCTGAATCCTCTGCTCTCGAGAGCAGAGGATTCAGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-400s1c1
Sequence:CCGGGAAGTGAGACATCTGAATCCTCTCGAGAGGATTCAGATGTCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-203s1c1
Sequence:CCGGCCCTTCCCTTCAGTGCCTCTTCTCGAGAAGAGGCACTGAAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012715
C9orf106 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 106
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-672s1c1
Sequence:CCGGCCTAAGAAAGTTCCCAGTTCTCTCGAGAGAACTGGGAACTTTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143162    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-2472s1c1
Sequence:CCGGGCAATCAATCTCTCTCCTCAACTCGAGTTGAGGAGAGAGATTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143051    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-397s1c1
Sequence:CCGGCAGGAAGTGAGACATCTGAATCTCGAGATTCAGATGTCTCACTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-407s1c1
Sequence:CCGGGACATCTGAATCCTCTGCTCTCTCGAGAGAGCAGAGGATTCAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-669s1c1
Sequence:CCGGCCTCCTAAGAAAGTTCCCAGTCTCGAGACTGGGAACTTTCTTAGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139487    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001012715.1-1104s1c1
Sequence:CCGGCCCACCTCTCTGATAAGGATACTCGAGTATCCTTATCAGAGAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-591s1c1
Sequence:CCGGCCCTTTGTGTGTCCCATGTAACTCGAGTTACATGGGACACACAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001012715.1-405s1c1
Sequence:CCGGGAGACATCTGAATCCTCTGCTCTCGAGAGCAGAGGATTCAGATGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143730    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-400s1c1
Sequence:CCGGGAAGTGAGACATCTGAATCCTCTCGAGAGGATTCAGATGTCTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012715.1-203s1c1
Sequence:CCGGCCCTTCCCTTCAGTGCCTCTTCTCGAGAAGAGGCACTGAAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks