EMAIL THIS PAGE TO A FRIEND

C9orf114

chromosome 9 open reading frame 114

58 Gene Product Result for
Synonyms: CENP-32 HSPC109
Species: Human C9orf114(51490)
UniProtKB ID: Q5T280, Q0D2P6, Q6P469, Q6PGP9, Q6PIJ1, Q6PJV9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016390 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU223531 MISSION® esiRNA esiRNA targeting human C9orf114 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016390 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349381 predicted 1018
2 SASI_Hs02_00349382 predicted 1554
3 SASI_Hs01_00223046 predicted 925
4 SASI_Hs02_00349383 predicted 1455
5 SASI_Hs01_00223047 predicted 743
6 SASI_Hs02_00349384 predicted 1576
7 SASI_Hs01_00223048 predicted 885
8 SASI_Hs01_00223049 predicted 1324
9 SASI_Hs02_00349385 predicted 1019
10 SASI_Hs02_00349386 predicted 332
11 SASI_Hs01_00223045 predicted 886
12 SASI_Hs01_00223050 predicted 1229
13 SASI_Hs01_00223051 predicted 524
14 SASI_Hs01_00223052 predicted 741
15 SASI_Hs01_00223053 predicted 1182
16 SASI_Hs01_00223054 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016390
VALIDATED
C9orf114 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 114
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-237s1c1
Sequence:CCGGCGGCCCTACACACTGAGCGTACTCGAGTACGCTCAGTGTGTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1667s1c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-101s1c1
Sequence:CCGGGCAACAGAAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-666s1c1
Sequence:CCGGGAGGTGAAGATTGACAAGAACCTCGAGGTTCTTGTCAATCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-74s1c1
Sequence:CCGGCCAAAGGATTGAGTGGCGAAACTCGAGTTTCGCCACTCAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-340s1c1
Sequence:CCGGCCATCTTCTGTGTGGATGAGACTCGAGTCTCATCCACACAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-513s1c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1028s1c1
Sequence:CCGGCCTCTTTGACCTGTACGTCAACTCGAGTTGACGTACAGGTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-351s1c1
Sequence:CCGGGTGGATGAGATCGTGGTGTTTCTCGAGAAACACCACGATCTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-341s1c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-354s1c1
Sequence:CCGGGATGAGATCGTGGTGTTTGATCTCGAGATCAAACACCACGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-131s1c1
Sequence:CCGGGAAGGATCTCAAGCTGATGAACTCGAGTTCATCAGCTTGAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-341s21c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1015s21c1
Sequence:CCGGCTGAACCCAGTGTCCTCTTTGCTCGAGCAAAGAGGACACTGGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-513s21c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016390.2-1667s21c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1147s21c1
Sequence:CCGGGGCACACCTGAAAGTTCTAAGCTCGAGCTTAGAACTTTCAGGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016390
VALIDATED
C9orf114 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 114
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-237s1c1
Sequence:CCGGCGGCCCTACACACTGAGCGTACTCGAGTACGCTCAGTGTGTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1667s1c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-101s1c1
Sequence:CCGGGCAACAGAAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-666s1c1
Sequence:CCGGGAGGTGAAGATTGACAAGAACCTCGAGGTTCTTGTCAATCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-74s1c1
Sequence:CCGGCCAAAGGATTGAGTGGCGAAACTCGAGTTTCGCCACTCAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-340s1c1
Sequence:CCGGCCATCTTCTGTGTGGATGAGACTCGAGTCTCATCCACACAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-513s1c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1028s1c1
Sequence:CCGGCCTCTTTGACCTGTACGTCAACTCGAGTTGACGTACAGGTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-351s1c1
Sequence:CCGGGTGGATGAGATCGTGGTGTTTCTCGAGAAACACCACGATCTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-341s1c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-354s1c1
Sequence:CCGGGATGAGATCGTGGTGTTTGATCTCGAGATCAAACACCACGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-131s1c1
Sequence:CCGGGAAGGATCTCAAGCTGATGAACTCGAGTTCATCAGCTTGAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-341s21c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1015s21c1
Sequence:CCGGCTGAACCCAGTGTCCTCTTTGCTCGAGCAAAGAGGACACTGGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-513s21c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016390.2-1667s21c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1147s21c1
Sequence:CCGGGGCACACCTGAAAGTTCTAAGCTCGAGCTTAGAACTTTCAGGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016390
VALIDATED
C9orf114 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 114
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-237s1c1
Sequence:CCGGCGGCCCTACACACTGAGCGTACTCGAGTACGCTCAGTGTGTAGGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1667s1c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-101s1c1
Sequence:CCGGGCAACAGAAGAAAGAGGAGAACTCGAGTTCTCCTCTTTCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-666s1c1
Sequence:CCGGGAGGTGAAGATTGACAAGAACCTCGAGGTTCTTGTCAATCTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-74s1c1
Sequence:CCGGCCAAAGGATTGAGTGGCGAAACTCGAGTTTCGCCACTCAATCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-340s1c1
Sequence:CCGGCCATCTTCTGTGTGGATGAGACTCGAGTCTCATCCACACAGAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-513s1c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-1028s1c1
Sequence:CCGGCCTCTTTGACCTGTACGTCAACTCGAGTTGACGTACAGGTCAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_016390.2-351s1c1
Sequence:CCGGGTGGATGAGATCGTGGTGTTTCTCGAGAAACACCACGATCTCATCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_016390.2-341s1c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143168    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-354s1c1
Sequence:CCGGGATGAGATCGTGGTGTTTGATCTCGAGATCAAACACCACGATCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016390.2-131s1c1
Sequence:CCGGGAAGGATCTCAAGCTGATGAACTCGAGTTCATCAGCTTGAGATCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-341s21c1
Sequence:CCGGCATCTTCTGTGTGGATGAGATCTCGAGATCTCATCCACACAGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1015s21c1
Sequence:CCGGCTGAACCCAGTGTCCTCTTTGCTCGAGCAAAGAGGACACTGGGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-513s21c1
Sequence:CCGGCACCAGGATCTACAGTTTGCACTCGAGTGCAAACTGTAGATCCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016390.2-1667s21c1
Sequence:CCGGCCCTGATCTGTCCTCTAACTTCTCGAGAAGTTAGAGGACAGATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016390.2-1147s21c1
Sequence:CCGGGGCACACCTGAAAGTTCTAAGCTCGAGCTTAGAACTTTCAGGTGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks