EMAIL THIS PAGE TO A FRIEND

C9orf116

chromosome 9 open reading frame 116

34 Gene Product Result for
Synonyms: PIERCE1 RbEST47
Species: Human C9orf116(138162)
UniProtKB ID: Q5BN46, Q5T897, Q8WU44
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA021439 Anti-C9orf116 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB3500708 Anti-C9orf116 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144654 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU131641 MISSION® esiRNA esiRNA human C9orf116 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048265 Rosetta Predictions human pricing
NM_144654 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311842 predicted 270
2 SASI_Hs02_00311843 predicted 404
3 SASI_Hs02_00311844 predicted 343
4 SASI_Hs02_00311845 predicted 266
5 SASI_Hs02_00311846 predicted 405
6 SASI_Hs02_00311847 predicted 322
7 SASI_Hs02_00311848 predicted 201
8 SASI_Hs02_00311849 predicted 270
9 SASI_Hs02_00311850 predicted 478
10 SASI_Hs02_00311851 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103449 predicted 298
2 SASI_Hs01_00103450 predicted 367
3 SASI_Hs02_00364532 predicted 299
4 SASI_Hs02_00364533 predicted 285
5 SASI_Hs01_00103452 predicted 268
6 SASI_Hs01_00103455 predicted 365
7 SASI_Hs01_00103456 predicted 430
8 SASI_Hs02_00364534 predicted 219
9 SASI_Hs02_00364535 predicted 293
10 SASI_Hs02_00364536 predicted 268
11 SASI_Hs01_00103447 predicted 329
12 SASI_Hs01_00103448 predicted 467
13 SASI_Hs01_00103451 predicted 311
14 SASI_Hs01_00103453 predicted 270
15 SASI_Hs01_00103454 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144654
VALIDATED
C9orf116 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 116
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-233s21c1
Sequence:CCGGAGGACCAGTAACCAGGCTTACCTCGAGGTAAGCCTGGTTACTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-213s21c1
Sequence:CCGGAGAAGGCTGTCTCCGTGTACACTCGAGTGTACACGGAGACAGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-494s21c1
Sequence:CCGGATCACCCACAGTCGCCCGATTCTCGAGAATCGGGCGACTGTGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-127s21c1
Sequence:CCGGGGAGAGGACCAGCGACTACTACTCGAGTAGTAGTCGCTGGTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-366s21c1
Sequence:CCGGCTCCTGTGACCGGCTCAACTTCTCGAGAAGTTGAGCCGGTCACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-279s21c1
Sequence:CCGGAGATGCCTCGGGTGGAATGTTCTCGAGAACATTCCACCCGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-412s1c1
Sequence:CCGGCAATACTCTCAATGTTTACCTCTCGAGAGGTAAACATTGAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-501s1c1
Sequence:CCGGGTTACAACATCAACAGGCCATCTCGAGATGGCCTGTTGATGTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-406s1c1
Sequence:CCGGCCGGAACAATACTCTCAATGTCTCGAGACATTGAGAGTATTGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-396s1c1
Sequence:CCGGGTGGAATGTTCCGGAACAATACTCGAGTATTGTTCCGGAACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144654
VALIDATED
C9orf116 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 116
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-233s21c1
Sequence:CCGGAGGACCAGTAACCAGGCTTACCTCGAGGTAAGCCTGGTTACTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-213s21c1
Sequence:CCGGAGAAGGCTGTCTCCGTGTACACTCGAGTGTACACGGAGACAGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-494s21c1
Sequence:CCGGATCACCCACAGTCGCCCGATTCTCGAGAATCGGGCGACTGTGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-127s21c1
Sequence:CCGGGGAGAGGACCAGCGACTACTACTCGAGTAGTAGTCGCTGGTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-366s21c1
Sequence:CCGGCTCCTGTGACCGGCTCAACTTCTCGAGAAGTTGAGCCGGTCACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-279s21c1
Sequence:CCGGAGATGCCTCGGGTGGAATGTTCTCGAGAACATTCCACCCGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-412s1c1
Sequence:CCGGCAATACTCTCAATGTTTACCTCTCGAGAGGTAAACATTGAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-501s1c1
Sequence:CCGGGTTACAACATCAACAGGCCATCTCGAGATGGCCTGTTGATGTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-406s1c1
Sequence:CCGGCCGGAACAATACTCTCAATGTCTCGAGACATTGAGAGTATTGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-396s1c1
Sequence:CCGGGTGGAATGTTCCGGAACAATACTCGAGTATTGTTCCGGAACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144654
VALIDATED
C9orf116 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 116
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-233s21c1
Sequence:CCGGAGGACCAGTAACCAGGCTTACCTCGAGGTAAGCCTGGTTACTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-213s21c1
Sequence:CCGGAGAAGGCTGTCTCCGTGTACACTCGAGTGTACACGGAGACAGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-494s21c1
Sequence:CCGGATCACCCACAGTCGCCCGATTCTCGAGAATCGGGCGACTGTGGGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-127s21c1
Sequence:CCGGGGAGAGGACCAGCGACTACTACTCGAGTAGTAGTCGCTGGTCCTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144654.2-366s21c1
Sequence:CCGGCTCCTGTGACCGGCTCAACTTCTCGAGAAGTTGAGCCGGTCACAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144654.2-279s21c1
Sequence:CCGGAGATGCCTCGGGTGGAATGTTCTCGAGAACATTCCACCCGAGGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122113    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-412s1c1
Sequence:CCGGCAATACTCTCAATGTTTACCTCTCGAGAGGTAAACATTGAGAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179784    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144654.1-501s1c1
Sequence:CCGGGTTACAACATCAACAGGCCATCTCGAGATGGCCTGTTGATGTTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-406s1c1
Sequence:CCGGCCGGAACAATACTCTCAATGTCTCGAGACATTGAGAGTATTGTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_144654.1-396s1c1
Sequence:CCGGGTGGAATGTTCCGGAACAATACTCGAGTATTGTTCCGGAACATTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks