EMAIL THIS PAGE TO A FRIEND

C9orf117

chromosome 9 open reading frame 117

38 Gene Product Result for
Species: Human C9orf117(286207)
UniProtKB ID: Q5JU67, A5D8T9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001012502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001012502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001012502 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037781 MISSION® esiRNA esiRNA human C9orf117 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012502 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00306157 predicted 1191
2 SASI_Hs02_00306158 predicted 516
3 SASI_Hs02_00306159 predicted 1190
4 SASI_Hs02_00306160 predicted 568
5 SASI_Hs02_00306161 predicted 445
6 SASI_Hs02_00306162 predicted 808
7 SASI_Hs02_00306163 predicted 247
8 SASI_Hs02_00306164 predicted 194
9 SASI_Hs02_00306165 predicted 521
10 SASI_Hs02_00306166 predicted 677
11 SASI_Hs01_00147292 predicted 1602
12 SASI_Hs01_00147293 predicted 1602
13 SASI_Hs01_00147294 predicted 1546
14 SASI_Hs01_00147295 predicted 1559
15 SASI_Hs01_00147296 predicted 1544
16 SASI_Hs01_00147297 predicted 1518
17 SASI_Hs01_00147298 predicted 1662
18 SASI_Hs01_00147299 predicted 1317
19 SASI_Hs01_00147300 predicted 1526
20 SASI_Hs01_00147301 predicted 1516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001012502
C9orf117 MISSION shRNA Bacterial Glycerol Stock
chromosome 9 open reading frame 117
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1547s1c1
Sequence:CCGGGAGCACTGAACTCACCAGTTACTCGAGTAACTGGTGAGTTCAGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1516s1c1
Sequence:CCGGGAACGGAGCTTCAAGAAGTTTCTCGAGAAACTTCTTGAAGCTCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-256s21c1
Sequence:CCGGGTTTGAGCAGCTGGCCAATAACTCGAGTTATTGGCCAGCTGCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1085s21c1
Sequence:CCGGCTACAGCAGGAACTGGCTAATCTCGAGATTAGCCAGTTCCTGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1470s21c1
Sequence:CCGGACCTCAGGCTGCTGTCATATACTCGAGTATATGACAGCAGCCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-567s21c1
Sequence:CCGGAGAATGAGTTCAGGGACTATGCTCGAGCATAGTCCCTGAACTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-723s21c1
Sequence:CCGGTCAAAGAGAACAACGGCATTACTCGAGTAATGCCGTTGTTCTCTTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001012502
C9orf117 MISSION shRNA shRNA Plasmid DNA
chromosome 9 open reading frame 117
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1547s1c1
Sequence:CCGGGAGCACTGAACTCACCAGTTACTCGAGTAACTGGTGAGTTCAGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1516s1c1
Sequence:CCGGGAACGGAGCTTCAAGAAGTTTCTCGAGAAACTTCTTGAAGCTCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000282939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-256s21c1
Sequence:CCGGGTTTGAGCAGCTGGCCAATAACTCGAGTTATTGGCCAGCTGCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1085s21c1
Sequence:CCGGCTACAGCAGGAACTGGCTAATCTCGAGATTAGCCAGTTCCTGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1470s21c1
Sequence:CCGGACCTCAGGCTGCTGTCATATACTCGAGTATATGACAGCAGCCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-567s21c1
Sequence:CCGGAGAATGAGTTCAGGGACTATGCTCGAGCATAGTCCCTGAACTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-723s21c1
Sequence:CCGGTCAAAGAGAACAACGGCATTACTCGAGTAATGCCGTTGTTCTCTTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001012502
C9orf117 MISSION shRNA Lentiviral Transduction Particles
chromosome 9 open reading frame 117
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1547s1c1
Sequence:CCGGGAGCACTGAACTCACCAGTTACTCGAGTAACTGGTGAGTTCAGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001012502.1-1516s1c1
Sequence:CCGGGAACGGAGCTTCAAGAAGTTTCTCGAGAAACTTCTTGAAGCTCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000282939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-256s21c1
Sequence:CCGGGTTTGAGCAGCTGGCCAATAACTCGAGTTATTGGCCAGCTGCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1085s21c1
Sequence:CCGGCTACAGCAGGAACTGGCTAATCTCGAGATTAGCCAGTTCCTGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-1470s21c1
Sequence:CCGGACCTCAGGCTGCTGTCATATACTCGAGTATATGACAGCAGCCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-567s21c1
Sequence:CCGGAGAATGAGTTCAGGGACTATGCTCGAGCATAGTCCCTGAACTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001012502.2-723s21c1
Sequence:CCGGTCAAAGAGAACAACGGCATTACTCGAGTAATGCCGTTGTTCTCTTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)